EMAIL THIS PAGE TO A FRIEND

GEMIN5

gem (nuclear organelle) associated protein 5

41 Gene Product Result for
Synonyms: GEMIN-5
UniProtKB ID: Q8TEQ6, Q14CV0, Q8WWV4, Q969W4, Q9H9K3, Q9UFI5
Gene ID:
Human(25929) Summary: This gene encodes a WD repeat protein that is a component of the survival of motor neurons (SMN) complex. The SMN complex plays a critical role in mRNA splicing through the assembly of spliceosomal small nuclear ribonucleoproteins (snRNPs), and may also mediate the assembly and transport of other classes of ribonucleoproteins. The encoded protein is the snRNA-binding component of the SMN complex. Dysregulation of this gene may play a role in alternative mRNA splicing and tumor cell motility. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(216766) gem (nuclear organelle) associated protein 5
Rat(691231) gem (nuclear organelle) associated protein 5
Zebrafish(799538) gem (nuclear organelle) associated protein 5
dog(479321) gem (nuclear organelle) associated protein 5
Horse(100071362) gem (nuclear organelle) associated protein 5
cow(533444) gem (nuclear organelle) associated protein 5
domestic cat(101083146) gem (nuclear organelle) associated protein 5
chicken(416254) gem (nuclear organelle) associated protein 5
naked mole-rat(101715025) gem (nuclear organelle) associated protein 5
domestic guinea pig(100728997) gem (nuclear organelle) associated protein 5
sheep(101110233) gem (nuclear organelle) associated protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015465 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172558 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172558 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172558 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015465 Rosetta Predictions human pricing
NM_172558 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347890 predicted 2666
2 SASI_Hs01_00238176 predicted 4091
3 SASI_Hs01_00238177 predicted 829
4 SASI_Hs02_00347891 predicted 3965
5 SASI_Hs01_00238178 predicted 428
6 SASI_Hs01_00238180 predicted 286
7 SASI_Hs02_00347892 predicted 2775
8 SASI_Hs01_00238182 predicted 903
9 SASI_Hs01_00238183 predicted 4285
10 SASI_Hs01_00238184 predicted 662
11 SASI_Hs01_00238175 predicted 469
12 SASI_Hs01_00238179 predicted 2835
13 SASI_Hs01_00238181 predicted 2948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044803 predicted 3132
2 SASI_Mm01_00044804 predicted 2714
3 SASI_Mm01_00044806 predicted 3852
4 SASI_Mm01_00044807 predicted 756
5 SASI_Mm01_00044808 predicted 1136
6 SASI_Mm01_00044809 predicted 2336
7 SASI_Mm01_00044811 predicted 209
8 SASI_Mm02_00344187 predicted 2648
9 SASI_Mm02_00344188 predicted 534
10 SASI_Mm02_00344189 predicted 1404
11 SASI_Mm01_00044805 predicted 475
12 SASI_Mm01_00044810 predicted 1391
13 SASI_Mm01_00044812 predicted 2575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015465
VALIDATED
GEMIN5 MISSION shRNA Bacterial Glycerol Stock
gem (nuclear organelle) associated protein 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015465.1-1615s1c1
Sequence:CCGGCACACAGAGATAAGTTGGAAACTCGAGTTTCCAACTTATCTCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015465.1-4201s1c1
Sequence:CCGGCCTGATAAGAATGAACCGGAACTCGAGTTCCGGTTCATTCTTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015465.1-2755s1c1
Sequence:CCGGCCTGAGTTATTTCACCAGCTTCTCGAGAAGCTGGTGAAATAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015465.1-1384s1c1
Sequence:CCGGCCACAGATTTCTAGCACATATCTCGAGATATGTGCTAGAAATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015465.1-737s1c1
Sequence:CCGGGCAAAGATCAAACCATTCGAACTCGAGTTCGAATGGTTTGATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015465.1-4204s1c1
Sequence:CCGGGATAAGAATGAACCGGAAGTACTCGAGTACTTCCGGTTCATTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015465.1-2249s1c1
Sequence:CCGGGAACTCCTGTAAAGCTGGAATCTCGAGATTCCAGCTTTACAGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015465.1-1701s1c1
Sequence:CCGGCCTGAAACTGATCTGTACTATCTCGAGATAGTACAGATCAGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015465.1-2653s1c1
Sequence:CCGGGCTGATGTTGAGGAAAGATTTCTCGAGAAATCTTTCCTCAACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015465.1-951s1c1
Sequence:CCGGGAGACGGAAATACACCCTCTTCTCGAGAAGAGGGTGTATTTCCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015465.1-2988s1c1
Sequence:CCGGGCTGCTCAAGTCAAACCATTTCTCGAGAAATGGTTTGACTTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015465.1-667s1c1
Sequence:CCGGGCTGAAATTACCAACGGGAATCTCGAGATTCCCGTTGGTAATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015465
VALIDATED
GEMIN5 MISSION shRNA shRNA Plasmid DNA
gem (nuclear organelle) associated protein 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015465.1-1615s1c1
Sequence:CCGGCACACAGAGATAAGTTGGAAACTCGAGTTTCCAACTTATCTCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015465.1-4201s1c1
Sequence:CCGGCCTGATAAGAATGAACCGGAACTCGAGTTCCGGTTCATTCTTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015465.1-2755s1c1
Sequence:CCGGCCTGAGTTATTTCACCAGCTTCTCGAGAAGCTGGTGAAATAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015465.1-1384s1c1
Sequence:CCGGCCACAGATTTCTAGCACATATCTCGAGATATGTGCTAGAAATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015465.1-737s1c1
Sequence:CCGGGCAAAGATCAAACCATTCGAACTCGAGTTCGAATGGTTTGATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015465.1-4204s1c1
Sequence:CCGGGATAAGAATGAACCGGAAGTACTCGAGTACTTCCGGTTCATTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015465.1-2249s1c1
Sequence:CCGGGAACTCCTGTAAAGCTGGAATCTCGAGATTCCAGCTTTACAGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015465.1-1701s1c1
Sequence:CCGGCCTGAAACTGATCTGTACTATCTCGAGATAGTACAGATCAGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015465.1-2653s1c1
Sequence:CCGGGCTGATGTTGAGGAAAGATTTCTCGAGAAATCTTTCCTCAACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015465.1-951s1c1
Sequence:CCGGGAGACGGAAATACACCCTCTTCTCGAGAAGAGGGTGTATTTCCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015465.1-2988s1c1
Sequence:CCGGGCTGCTCAAGTCAAACCATTTCTCGAGAAATGGTTTGACTTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015465.1-667s1c1
Sequence:CCGGGCTGAAATTACCAACGGGAATCTCGAGATTCCCGTTGGTAATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015465
VALIDATED
GEMIN5 MISSION shRNA Lentiviral Transduction Particles
gem (nuclear organelle) associated protein 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015465.1-1615s1c1
Sequence:CCGGCACACAGAGATAAGTTGGAAACTCGAGTTTCCAACTTATCTCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015465.1-4201s1c1
Sequence:CCGGCCTGATAAGAATGAACCGGAACTCGAGTTCCGGTTCATTCTTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015465.1-2755s1c1
Sequence:CCGGCCTGAGTTATTTCACCAGCTTCTCGAGAAGCTGGTGAAATAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015465.1-1384s1c1
Sequence:CCGGCCACAGATTTCTAGCACATATCTCGAGATATGTGCTAGAAATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015465.1-737s1c1
Sequence:CCGGGCAAAGATCAAACCATTCGAACTCGAGTTCGAATGGTTTGATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015465.1-4204s1c1
Sequence:CCGGGATAAGAATGAACCGGAAGTACTCGAGTACTTCCGGTTCATTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015465.1-2249s1c1
Sequence:CCGGGAACTCCTGTAAAGCTGGAATCTCGAGATTCCAGCTTTACAGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015465.1-1701s1c1
Sequence:CCGGCCTGAAACTGATCTGTACTATCTCGAGATAGTACAGATCAGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015465.1-2653s1c1
Sequence:CCGGGCTGATGTTGAGGAAAGATTTCTCGAGAAATCTTTCCTCAACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015465.1-951s1c1
Sequence:CCGGGAGACGGAAATACACCCTCTTCTCGAGAAGAGGGTGTATTTCCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015465.1-2988s1c1
Sequence:CCGGGCTGCTCAAGTCAAACCATTTCTCGAGAAATGGTTTGACTTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015465.1-667s1c1
Sequence:CCGGGCTGAAATTACCAACGGGAATCTCGAGATTCCCGTTGGTAATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172558
VALIDATED
GEMIN5 MISSION shRNA Bacterial Glycerol Stock
gem (nuclear organelle) associated protein 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172558.1-1405s1c1
Sequence:CCGGCCACAGATTTCAAGCACGTATCTCGAGATACGTGCTTGAAATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172558.1-4627s1c1
Sequence:CCGGGCTGTGATCCAACTGACAGATCTCGAGATCTGTCAGTTGGATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172558.1-3751s1c1
Sequence:CCGGCAGGAAATCTACTCAGCCTTTCTCGAGAAAGGCTGAGTAGATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172558.1-857s1c1
Sequence:CCGGCAACAGTTAAAGAACGGCTTTCTCGAGAAAGCCGTTCTTTAACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172558
VALIDATED
GEMIN5 MISSION shRNA shRNA Plasmid DNA
gem (nuclear organelle) associated protein 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172558.1-1405s1c1
Sequence:CCGGCCACAGATTTCAAGCACGTATCTCGAGATACGTGCTTGAAATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172558.1-4627s1c1
Sequence:CCGGGCTGTGATCCAACTGACAGATCTCGAGATCTGTCAGTTGGATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172558.1-3751s1c1
Sequence:CCGGCAGGAAATCTACTCAGCCTTTCTCGAGAAAGGCTGAGTAGATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172558.1-857s1c1
Sequence:CCGGCAACAGTTAAAGAACGGCTTTCTCGAGAAAGCCGTTCTTTAACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172558
VALIDATED
GEMIN5 MISSION shRNA Lentiviral Transduction Particles
gem (nuclear organelle) associated protein 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172558.1-1405s1c1
Sequence:CCGGCCACAGATTTCAAGCACGTATCTCGAGATACGTGCTTGAAATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172558.1-4627s1c1
Sequence:CCGGGCTGTGATCCAACTGACAGATCTCGAGATCTGTCAGTTGGATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172558.1-3751s1c1
Sequence:CCGGCAGGAAATCTACTCAGCCTTTCTCGAGAAAGGCTGAGTAGATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172558.1-857s1c1
Sequence:CCGGCAACAGTTAAAGAACGGCTTTCTCGAGAAAGCCGTTCTTTAACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks