EMAIL THIS PAGE TO A FRIEND

GEMIN6

gem (nuclear organelle) associated protein 6

UniProtKB ID: Q8WXD5, B2RDP8, Q53SI5, Q8WVB4, Q9H5G6
Gene ID:
Human(79833) Summary: GEMIN6 is part of a large macromolecular complex, localized to both the cytoplasm and the nucleus, that plays a role in the cytoplasmic assembly of small nuclear ribonucleoproteins (snRNPs). Other members of this complex include SMN (MIM 600354), GEMIN2 (SIP1; MIM 602595), GEMIN3 (DDX20; MIM 606168), GEMIN4 (MIM 606969), and GEMIN5 (MIM 607005).[supplied by OMIM, Jul 2002]
Mouse(67242) gem (nuclear organelle) associated protein 6
Rat(362688) gem (nuclear organelle) associated protein 6
sheep(101118517) gem (nuclear organelle) associated protein 6
domestic guinea pig(100714686) gem (nuclear organelle) associated protein 6
naked mole-rat(101705344) gem (nuclear organelle) associated protein 6
chicken(426266) gem (nuclear organelle) associated protein 6
domestic cat(101096308) gem (nuclear organelle) associated protein 6
dog(475732) gem (nuclear organelle) associated protein 6
cow(525263) gem (nuclear organelle) associated protein 6
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026053 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026053 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026053 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024775 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024775 Rosetta Predictions human pricing
NM_001009466 Rosetta Predictions rat pricing
NM_026053 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168639 predicted 424
2 SASI_Hs01_00168640 predicted 268
3 SASI_Hs01_00168642 predicted 352
4 SASI_Hs01_00168643 predicted 251
5 SASI_Hs01_00168644 predicted 250
6 SASI_Hs01_00168645 predicted 302
7 SASI_Hs01_00168646 predicted 429
8 SASI_Hs01_00168647 predicted 285
9 SASI_Hs01_00168648 predicted 300
10 SASI_Hs02_00357287 predicted 359
11 SASI_Hs01_00168641 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093022 predicted 454
2 SASI_Rn01_00093023 predicted 490
3 SASI_Rn01_00093024 predicted 299
4 SASI_Rn01_00093025 predicted 320
5 SASI_Rn01_00093026 predicted 465
6 SASI_Rn01_00093027 predicted 285
7 SASI_Rn01_00093028 predicted 476
8 SASI_Rn01_00093029 predicted 391
9 SASI_Rn01_00093030 predicted 501
10 SASI_Rn02_00199548 predicted 313
11 SASI_Rn01_00093031 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057107 predicted 443
2 SASI_Mm01_00057108 predicted 330
3 SASI_Mm01_00057109 predicted 303
4 SASI_Mm01_00057110 predicted 384
5 SASI_Mm01_00057111 predicted 271
6 SASI_Mm01_00057112 predicted 234
7 SASI_Mm01_00057113 predicted 695
8 SASI_Mm01_00057114 predicted 393
9 SASI_Mm01_00057115 predicted 509
10 SASI_Mm01_00057116 predicted 230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026053
VALIDATED
GEMIN6 MISSION shRNA Bacterial Glycerol Stock
gem (nuclear organelle) associated protein 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026053.1-879s1c1
Sequence:CCGGCCTTAGGAATTGAAGGTACAACTCGAGTTGTACCTTCAATTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026053.1-438s1c1
Sequence:CCGGGAGAAGCTGATGCATGTGTTTCTCGAGAAACACATGCATCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026053.1-645s1c1
Sequence:CCGGGAGATCATTCTGTCCCGAATTCTCGAGAATTCGGGACAGAATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026053.1-322s1c1
Sequence:CCGGCTGCCAACATTGTCCTCGTAACTCGAGTTACGAGGACAATGTTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026053.1-333s1c1
Sequence:CCGGGTCCTCGTAAACTTCCTTGAACTCGAGTTCAAGGAAGTTTACGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026053.3-806s21c1
Sequence:CCGGTATAGGTGTGTGTGCGTATTTCTCGAGAAATACGCACACACACCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026053.3-321s21c1
Sequence:CCGGTGCCAACATTGTCCTCGTAAACTCGAGTTTACGAGGACAATGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026053.3-232s21c1
Sequence:CCGGGAATGGGAAGATTACGTTTATCTCGAGATAAACGTAATCTTCCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026053.3-271s21c1
Sequence:CCGGGCCTGTGAGAAGGAGTATAAACTCGAGTTTATACTCCTTCTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026053.3-632s21c1
Sequence:CCGGGCAGCTCCAATGAGATCATTCCTCGAGGAATGATCTCATTGGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026053
VALIDATED
GEMIN6 MISSION shRNA shRNA Plasmid DNA
gem (nuclear organelle) associated protein 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026053.1-879s1c1
Sequence:CCGGCCTTAGGAATTGAAGGTACAACTCGAGTTGTACCTTCAATTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026053.1-438s1c1
Sequence:CCGGGAGAAGCTGATGCATGTGTTTCTCGAGAAACACATGCATCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026053.1-645s1c1
Sequence:CCGGGAGATCATTCTGTCCCGAATTCTCGAGAATTCGGGACAGAATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026053.1-322s1c1
Sequence:CCGGCTGCCAACATTGTCCTCGTAACTCGAGTTACGAGGACAATGTTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026053.1-333s1c1
Sequence:CCGGGTCCTCGTAAACTTCCTTGAACTCGAGTTCAAGGAAGTTTACGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026053.3-806s21c1
Sequence:CCGGTATAGGTGTGTGTGCGTATTTCTCGAGAAATACGCACACACACCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026053.3-321s21c1
Sequence:CCGGTGCCAACATTGTCCTCGTAAACTCGAGTTTACGAGGACAATGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026053.3-232s21c1
Sequence:CCGGGAATGGGAAGATTACGTTTATCTCGAGATAAACGTAATCTTCCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026053.3-271s21c1
Sequence:CCGGGCCTGTGAGAAGGAGTATAAACTCGAGTTTATACTCCTTCTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026053.3-632s21c1
Sequence:CCGGGCAGCTCCAATGAGATCATTCCTCGAGGAATGATCTCATTGGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026053
VALIDATED
GEMIN6 MISSION shRNA Lentiviral Transduction Particles
gem (nuclear organelle) associated protein 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026053.1-879s1c1
Sequence:CCGGCCTTAGGAATTGAAGGTACAACTCGAGTTGTACCTTCAATTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026053.1-438s1c1
Sequence:CCGGGAGAAGCTGATGCATGTGTTTCTCGAGAAACACATGCATCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026053.1-645s1c1
Sequence:CCGGGAGATCATTCTGTCCCGAATTCTCGAGAATTCGGGACAGAATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026053.1-322s1c1
Sequence:CCGGCTGCCAACATTGTCCTCGTAACTCGAGTTACGAGGACAATGTTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026053.1-333s1c1
Sequence:CCGGGTCCTCGTAAACTTCCTTGAACTCGAGTTCAAGGAAGTTTACGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026053.3-806s21c1
Sequence:CCGGTATAGGTGTGTGTGCGTATTTCTCGAGAAATACGCACACACACCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026053.3-321s21c1
Sequence:CCGGTGCCAACATTGTCCTCGTAAACTCGAGTTTACGAGGACAATGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026053.3-232s21c1
Sequence:CCGGGAATGGGAAGATTACGTTTATCTCGAGATAAACGTAATCTTCCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026053.3-271s21c1
Sequence:CCGGGCCTGTGAGAAGGAGTATAAACTCGAGTTTATACTCCTTCTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026053.3-632s21c1
Sequence:CCGGGCAGCTCCAATGAGATCATTCCTCGAGGAATGATCTCATTGGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024775
VALIDATED
GEMIN6 MISSION shRNA Bacterial Glycerol Stock
gem (nuclear organelle) associated protein 6
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024775.9-414s1c1
Sequence:CCGGGAAGAGAGAAAGAACAGCCTACTCGAGTAGGCTGTTCTTTCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024775.9-187s1c1
Sequence:CCGGCCAGTGAGAAGAATGAGTATACTCGAGTATACTCATTCTTCTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024775.9-252s1c1
Sequence:CCGGCTTGTGAACTTCCTTGAAGATCTCGAGATCTTCAAGGAAGTTCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024775.9-311s1c1
Sequence:CCGGGCAGACTGTTGAAACTATGAACTCGAGTTCATAGTTTCAACAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024775.9-161s1c1
Sequence:CCGGCATTTACAAAGAGGTCCGAGTCTCGAGACTCGGACCTCTTTGTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024775.9-307s1c1
Sequence:CCGGCTGTGCAGACTGTTGAAACTACTCGAGTAGTTTCAACAGTCTGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024775.9-430s1c1
Sequence:CCGGGCCTAAAGAAATGGCTTGAGACTCGAGTCTCAAGCCATTTCTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024775.9-234s1c1
Sequence:CCGGGTCTCTGCCAATATTGTCCTTCTCGAGAAGGACAATATTGGCAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024775.9-161s21c1
Sequence:CCGGCATTTACAAAGAGGTCCGAGTCTCGAGACTCGGACCTCTTTGTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024775.9-252s21c1
Sequence:CCGGCTTGTGAACTTCCTTGAAGATCTCGAGATCTTCAAGGAAGTTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024775.9-311s21c1
Sequence:CCGGGCAGACTGTTGAAACTATGAACTCGAGTTCATAGTTTCAACAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024775.9-187s21c1
Sequence:CCGGCCAGTGAGAAGAATGAGTATACTCGAGTATACTCATTCTTCTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024775
VALIDATED
GEMIN6 MISSION shRNA shRNA Plasmid DNA
gem (nuclear organelle) associated protein 6
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024775.9-414s1c1
Sequence:CCGGGAAGAGAGAAAGAACAGCCTACTCGAGTAGGCTGTTCTTTCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024775.9-187s1c1
Sequence:CCGGCCAGTGAGAAGAATGAGTATACTCGAGTATACTCATTCTTCTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024775.9-252s1c1
Sequence:CCGGCTTGTGAACTTCCTTGAAGATCTCGAGATCTTCAAGGAAGTTCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024775.9-311s1c1
Sequence:CCGGGCAGACTGTTGAAACTATGAACTCGAGTTCATAGTTTCAACAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024775.9-161s1c1
Sequence:CCGGCATTTACAAAGAGGTCCGAGTCTCGAGACTCGGACCTCTTTGTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024775.9-307s1c1
Sequence:CCGGCTGTGCAGACTGTTGAAACTACTCGAGTAGTTTCAACAGTCTGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024775.9-430s1c1
Sequence:CCGGGCCTAAAGAAATGGCTTGAGACTCGAGTCTCAAGCCATTTCTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024775.9-234s1c1
Sequence:CCGGGTCTCTGCCAATATTGTCCTTCTCGAGAAGGACAATATTGGCAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024775.9-161s21c1
Sequence:CCGGCATTTACAAAGAGGTCCGAGTCTCGAGACTCGGACCTCTTTGTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024775.9-252s21c1
Sequence:CCGGCTTGTGAACTTCCTTGAAGATCTCGAGATCTTCAAGGAAGTTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024775.9-311s21c1
Sequence:CCGGGCAGACTGTTGAAACTATGAACTCGAGTTCATAGTTTCAACAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024775.9-187s21c1
Sequence:CCGGCCAGTGAGAAGAATGAGTATACTCGAGTATACTCATTCTTCTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024775
VALIDATED
GEMIN6 MISSION shRNA Lentiviral Transduction Particles
gem (nuclear organelle) associated protein 6
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024775.9-414s1c1
Sequence:CCGGGAAGAGAGAAAGAACAGCCTACTCGAGTAGGCTGTTCTTTCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024775.9-187s1c1
Sequence:CCGGCCAGTGAGAAGAATGAGTATACTCGAGTATACTCATTCTTCTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024775.9-252s1c1
Sequence:CCGGCTTGTGAACTTCCTTGAAGATCTCGAGATCTTCAAGGAAGTTCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024775.9-311s1c1
Sequence:CCGGGCAGACTGTTGAAACTATGAACTCGAGTTCATAGTTTCAACAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024775.9-161s1c1
Sequence:CCGGCATTTACAAAGAGGTCCGAGTCTCGAGACTCGGACCTCTTTGTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024775.9-307s1c1
Sequence:CCGGCTGTGCAGACTGTTGAAACTACTCGAGTAGTTTCAACAGTCTGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024775.9-430s1c1
Sequence:CCGGGCCTAAAGAAATGGCTTGAGACTCGAGTCTCAAGCCATTTCTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024775.9-234s1c1
Sequence:CCGGGTCTCTGCCAATATTGTCCTTCTCGAGAAGGACAATATTGGCAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024775.9-161s21c1
Sequence:CCGGCATTTACAAAGAGGTCCGAGTCTCGAGACTCGGACCTCTTTGTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024775.9-252s21c1
Sequence:CCGGCTTGTGAACTTCCTTGAAGATCTCGAGATCTTCAAGGAAGTTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024775.9-311s21c1
Sequence:CCGGGCAGACTGTTGAAACTATGAACTCGAGTTCATAGTTTCAACAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024775.9-187s21c1
Sequence:CCGGCCAGTGAGAAGAATGAGTATACTCGAGTATACTCATTCTTCTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks