EMAIL THIS PAGE TO A FRIEND

GEMIN7

gem (nuclear organelle) associated protein 7

Synonyms: SIP3
UniProtKB ID: Q9H840, Q6IA34
Gene ID:
Human(79760) Summary: The protein encoded by this gene is a component of the core SMN complex, which is required for pre-mRNA splicing in the nucleus. The encoded protein is found in the nucleoplasm, in nuclear 'gems' (Gemini of Cajal bodies), and in the cytoplasm. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(69731) gem (nuclear organelle) associated protein 7
Rat(499391) gem (nuclear organelle) associated protein 7
cow(618024) gem (nuclear organelle) associated protein 7
domestic cat(101096622) gem (nuclear organelle) associated protein 7
dog(612319) gem (nuclear organelle) associated protein 7
naked mole-rat(101727412) gem (nuclear organelle) associated protein 7
domestic guinea pig(100732455) gem (nuclear organelle) associated protein 7
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024707 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007269 Rosetta Predictions human pricing
NM_001007270 Rosetta Predictions human pricing
NM_024707 Rosetta Predictions human pricing
NM_001109170 Rosetta Predictions rat pricing
NM_027189 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198746 predicted 461
2 SASI_Hs01_00198748 predicted 977
3 SASI_Hs01_00198749 predicted 472
4 SASI_Hs01_00198750 predicted 593
5 SASI_Hs01_00198751 predicted 693
6 SASI_Hs01_00198752 predicted 978
7 SASI_Hs01_00198753 predicted 712
8 SASI_Hs01_00198754 predicted 652
9 SASI_Hs02_00305295 predicted 840
10 SASI_Hs01_00198755 predicted 462
11 SASI_Hs01_00198747 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151849 predicted 498
2 SASI_Hs01_00151851 predicted 1008
3 SASI_Hs01_00151852 predicted 514
4 SASI_Hs01_00151853 predicted 635
5 SASI_Hs01_00151854 predicted 724
6 SASI_Hs01_00151855 predicted 1013
7 SASI_Hs01_00151856 predicted 750
8 SASI_Hs01_00151857 predicted 686
9 SASI_Hs02_00305296 predicted 877
10 SASI_Hs01_00151858 predicted 506
11 SASI_Hs01_00151850 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217546 predicted 582
2 SASI_Hs01_00217548 predicted 1094
3 SASI_Hs01_00217549 predicted 601
4 SASI_Hs01_00217550 predicted 720
5 SASI_Hs01_00217551 predicted 816
6 SASI_Hs01_00217552 predicted 1104
7 SASI_Hs01_00217553 predicted 840
8 SASI_Hs01_00217554 predicted 772
9 SASI_Hs02_00357165 predicted 963
10 SASI_Hs01_00217555 predicted 585
11 SASI_Hs01_00217547 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109170 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245810 predicted 274
2 SASI_Rn02_00245811 predicted 704
3 SASI_Rn02_00245812 predicted 555
4 SASI_Rn02_00245813 predicted 256
5 SASI_Rn02_00245814 predicted 759
6 SASI_Rn02_00245815 predicted 682
7 SASI_Rn02_00245816 predicted 629
8 SASI_Rn02_00245817 predicted 725
9 SASI_Rn02_00245818 predicted 567
10 SASI_Rn02_00245819 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112194 predicted 456
2 SASI_Mm02_00331723 predicted 333
3 SASI_Mm01_00112195 predicted 397
4 SASI_Mm01_00112196 predicted 539
5 SASI_Mm01_00112197 predicted 385
6 SASI_Mm01_00112198 predicted 289
7 SASI_Mm01_00112199 predicted 474
8 SASI_Mm01_00112200 predicted 391
9 SASI_Mm01_00112202 predicted 379
10 SASI_Mm01_00112203 predicted 211
11 SASI_Mm01_00112201 predicted 522
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024707
VALIDATED
GEMIN7 MISSION shRNA Bacterial Glycerol Stock
gem (nuclear organelle) associated protein 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024707.2-366s21c1
Sequence:CCGGGTGTCCCATAGCTCAAGAATCCTCGAGGATTCTTGAGCTATGGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024707.2-725s21c1
Sequence:CCGGTTATGAGCTCCCTTGGAATTTCTCGAGAAATTCCAAGGGAGCTCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024707.2-858s1c1
Sequence:CCGGGAACTCTGAACCCTACAGAAACTCGAGTTTCTGTAGGGTTCAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140333    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024707.2-830s1c1
Sequence:CCGGCCCATTGGAAGGAATGCTCTACTCGAGTAGAGCATTCCTTCCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024707.2-355s1c1
Sequence:CCGGGAAATCCAGGAGTGTCCCATACTCGAGTATGGGACACTCCTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024707.2-656s1c1
Sequence:CCGGCTTGAGGCTAAGGCACTGTATCTCGAGATACAGTGCCTTAGCCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024707.2-1441s1c1
Sequence:CCGGCAACTTCACTCCCTCCTCTTTCTCGAGAAAGAGGAGGGAGTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024707
VALIDATED
GEMIN7 MISSION shRNA shRNA Plasmid DNA
gem (nuclear organelle) associated protein 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024707.2-366s21c1
Sequence:CCGGGTGTCCCATAGCTCAAGAATCCTCGAGGATTCTTGAGCTATGGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024707.2-725s21c1
Sequence:CCGGTTATGAGCTCCCTTGGAATTTCTCGAGAAATTCCAAGGGAGCTCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024707.2-858s1c1
Sequence:CCGGGAACTCTGAACCCTACAGAAACTCGAGTTTCTGTAGGGTTCAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140333    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024707.2-830s1c1
Sequence:CCGGCCCATTGGAAGGAATGCTCTACTCGAGTAGAGCATTCCTTCCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024707.2-355s1c1
Sequence:CCGGGAAATCCAGGAGTGTCCCATACTCGAGTATGGGACACTCCTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024707.2-656s1c1
Sequence:CCGGCTTGAGGCTAAGGCACTGTATCTCGAGATACAGTGCCTTAGCCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024707.2-1441s1c1
Sequence:CCGGCAACTTCACTCCCTCCTCTTTCTCGAGAAAGAGGAGGGAGTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024707
VALIDATED
GEMIN7 MISSION shRNA Lentiviral Transduction Particles
gem (nuclear organelle) associated protein 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024707.2-366s21c1
Sequence:CCGGGTGTCCCATAGCTCAAGAATCCTCGAGGATTCTTGAGCTATGGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024707.2-725s21c1
Sequence:CCGGTTATGAGCTCCCTTGGAATTTCTCGAGAAATTCCAAGGGAGCTCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024707.2-858s1c1
Sequence:CCGGGAACTCTGAACCCTACAGAAACTCGAGTTTCTGTAGGGTTCAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140333    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024707.2-830s1c1
Sequence:CCGGCCCATTGGAAGGAATGCTCTACTCGAGTAGAGCATTCCTTCCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024707.2-355s1c1
Sequence:CCGGGAAATCCAGGAGTGTCCCATACTCGAGTATGGGACACTCCTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024707.2-656s1c1
Sequence:CCGGCTTGAGGCTAAGGCACTGTATCTCGAGATACAGTGCCTTAGCCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024707.2-1441s1c1
Sequence:CCGGCAACTTCACTCCCTCCTCTTTCTCGAGAAAGAGGAGGGAGTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027189
VALIDATED
GEMIN7 MISSION shRNA Bacterial Glycerol Stock
gem (nuclear organelle) associated protein 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027189.2-538s21c1
Sequence:CCGGCCAACAAACTCTGGCTTTGAACTCGAGTTCAAAGCCAGAGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027189.2-158s21c1
Sequence:CCGGGAAGTCGGAGAAGGTCATATTCTCGAGAATATGACCTTCTCCGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027189.2-120s21c1
Sequence:CCGGGCTTTGCCTCTGATGGACGTACTCGAGTACGTCCATCAGAGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027189.2-335s21c1
Sequence:CCGGGCCAACTTCTACGTTTCCCAACTCGAGTTGGGAAACGTAGAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027189.2-391s21c1
Sequence:CCGGGCTTCGATGTAGTGACATAATCTCGAGATTATGTCACTACATCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027189.1-122s1c1
Sequence:CCGGGCTTTGCCTCTGATGGACGTACTCGAGTACGTCCATCAGAGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027189.1-160s1c1
Sequence:CCGGGAAGTCGGAGAAGGTCATATTCTCGAGAATATGACCTTCTCCGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027189.1-337s1c1
Sequence:CCGGGCCAACTTCTACGTTTCCCAACTCGAGTTGGGAAACGTAGAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027189.1-393s1c1
Sequence:CCGGGCTTCGATGTAGTGACATAATCTCGAGATTATGTCACTACATCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027189.1-540s1c1
Sequence:CCGGCCAACAAACTCTGGCTTTGAACTCGAGTTCAAAGCCAGAGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027189
VALIDATED
GEMIN7 MISSION shRNA shRNA Plasmid DNA
gem (nuclear organelle) associated protein 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027189.2-538s21c1
Sequence:CCGGCCAACAAACTCTGGCTTTGAACTCGAGTTCAAAGCCAGAGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027189.2-158s21c1
Sequence:CCGGGAAGTCGGAGAAGGTCATATTCTCGAGAATATGACCTTCTCCGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027189.2-120s21c1
Sequence:CCGGGCTTTGCCTCTGATGGACGTACTCGAGTACGTCCATCAGAGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027189.2-335s21c1
Sequence:CCGGGCCAACTTCTACGTTTCCCAACTCGAGTTGGGAAACGTAGAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027189.2-391s21c1
Sequence:CCGGGCTTCGATGTAGTGACATAATCTCGAGATTATGTCACTACATCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027189.1-122s1c1
Sequence:CCGGGCTTTGCCTCTGATGGACGTACTCGAGTACGTCCATCAGAGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027189.1-160s1c1
Sequence:CCGGGAAGTCGGAGAAGGTCATATTCTCGAGAATATGACCTTCTCCGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027189.1-337s1c1
Sequence:CCGGGCCAACTTCTACGTTTCCCAACTCGAGTTGGGAAACGTAGAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027189.1-393s1c1
Sequence:CCGGGCTTCGATGTAGTGACATAATCTCGAGATTATGTCACTACATCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027189.1-540s1c1
Sequence:CCGGCCAACAAACTCTGGCTTTGAACTCGAGTTCAAAGCCAGAGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027189
VALIDATED
GEMIN7 MISSION shRNA Lentiviral Transduction Particles
gem (nuclear organelle) associated protein 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027189.2-538s21c1
Sequence:CCGGCCAACAAACTCTGGCTTTGAACTCGAGTTCAAAGCCAGAGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027189.2-158s21c1
Sequence:CCGGGAAGTCGGAGAAGGTCATATTCTCGAGAATATGACCTTCTCCGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027189.2-120s21c1
Sequence:CCGGGCTTTGCCTCTGATGGACGTACTCGAGTACGTCCATCAGAGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027189.2-335s21c1
Sequence:CCGGGCCAACTTCTACGTTTCCCAACTCGAGTTGGGAAACGTAGAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027189.2-391s21c1
Sequence:CCGGGCTTCGATGTAGTGACATAATCTCGAGATTATGTCACTACATCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027189.1-122s1c1
Sequence:CCGGGCTTTGCCTCTGATGGACGTACTCGAGTACGTCCATCAGAGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027189.1-160s1c1
Sequence:CCGGGAAGTCGGAGAAGGTCATATTCTCGAGAATATGACCTTCTCCGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027189.1-337s1c1
Sequence:CCGGGCCAACTTCTACGTTTCCCAACTCGAGTTGGGAAACGTAGAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027189.1-393s1c1
Sequence:CCGGGCTTCGATGTAGTGACATAATCTCGAGATTATGTCACTACATCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027189.1-540s1c1
Sequence:CCGGCCAACAAACTCTGGCTTTGAACTCGAGTTCAAAGCCAGAGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks