EMAIL THIS PAGE TO A FRIEND

GEMIN8

gem (nuclear organelle) associated protein 8

148 Gene Product Result for
Synonyms: FAM51A1
UniProtKB ID: Q9NWZ8, C4AMC4, Q2LJ66, Q6ZV27
Gene ID:
Human(54960) Summary: The protein encoded by this gene is part of the SMN complex, which is necessary for spliceosomal snRNP assembly in the cytoplasm and pre-mRNA splicing in the nucleus. The encoded protein binds to both SMN1 and the GEMIN6/GEMIN7 heterodimer, mediating their interaction. This protein is found in nuclear Gemini of Cajal bodies (gems) and in the cytoplasm. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]
Mouse(237221) gem (nuclear organelle) associated protein 8
Rat(363462) gem (nuclear organelle) associated protein 8
domestic guinea pig(100734773) gem (nuclear organelle) associated protein 8
naked mole-rat(101721613) gem (nuclear organelle) associated protein 8
sheep(101121147) gem (nuclear organelle) associated protein 8
Zebrafish(100000842) gem (nuclear organelle) associated protein 8
dog(480843) gem (nuclear organelle) associated protein 8
chicken(418631) gem (nuclear organelle) associated protein 8
cow(515968) gem (nuclear organelle) associated protein 8
domestic cat(101093247) gem (nuclear organelle) associated protein 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA028613 Anti-GEMIN8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
G5796 Monoclonal Anti-Gemin 8 antibody produced in mouse ~1 mg/mL, clone 1F8, purified immunoglobulin, buffered aqueous solution human, rat, mouse, canine
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146238 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146238 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146238 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017856 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042479 Rosetta Predictions human pricing
NM_001042480 Rosetta Predictions human pricing
NM_017856 Rosetta Predictions human pricing
NM_001007756 Rosetta Predictions rat pricing
NM_146238 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310058 predicted 466
2 SASI_Hs02_00310059 predicted 1216
3 SASI_Hs02_00310060 predicted 553
4 SASI_Hs02_00310061 predicted 460
5 SASI_Hs02_00310062 predicted 546
6 SASI_Hs02_00310063 predicted 589
7 SASI_Hs02_00310064 predicted 979
8 SASI_Hs02_00310065 predicted 267
9 SASI_Hs02_00310066 predicted 356
10 SASI_Hs02_00310067 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310068 predicted 382
2 SASI_Hs02_00310069 predicted 1130
3 SASI_Hs02_00310070 predicted 465
4 SASI_Hs02_00310071 predicted 379
5 SASI_Hs02_00310072 predicted 465
6 SASI_Hs02_00310073 predicted 513
7 SASI_Hs02_00310074 predicted 894
8 SASI_Hs02_00310075 predicted 179
9 SASI_Hs02_00310076 predicted 271
10 SASI_Hs02_00310077 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350760 predicted 552
2 SASI_Hs01_00039246 predicted 1304
3 SASI_Hs01_00039247 predicted 636
4 SASI_Hs02_00350761 predicted 549
5 SASI_Hs02_00350762 predicted 630
6 SASI_Hs02_00350763 predicted 678
7 SASI_Hs02_00350764 predicted 1066
8 SASI_Hs01_00039241 predicted 354
9 SASI_Hs01_00039243 predicted 437
10 SASI_Hs01_00039244 predicted 378
11 SASI_Hs01_00039242 predicted 386
12 SASI_Hs01_00039245 predicted 462
13 SASI_Hs01_00039248 predicted 479
14 SASI_Hs01_00039249 predicted 480
15 SASI_Hs01_00039250 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198949 predicted 609
2 SASI_Rn01_00062500 predicted 389
3 SASI_Rn01_00062501 predicted 306
4 SASI_Rn01_00062502 predicted 225
5 SASI_Rn02_00198950 predicted 369
6 SASI_Rn02_00198951 predicted 599
7 SASI_Rn01_00062503 predicted 235
8 SASI_Rn02_00198952 predicted 509
9 SASI_Rn01_00062504 predicted 630
10 SASI_Rn01_00062505 predicted 559
11 SASI_Rn01_00062506 predicted 393
12 SASI_Rn01_00062507 predicted 886
13 SASI_Rn01_00062508 predicted 271
14 SASI_Rn01_00062509 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341947 predicted 838
2 SASI_Mm02_00341948 predicted 215
3 SASI_Mm02_00341949 predicted 1126
4 SASI_Mm02_00341950 predicted 1128
5 SASI_Mm02_00341951 predicted 686
6 SASI_Mm02_00341952 predicted 1126
7 SASI_Mm02_00341953 predicted 496
8 SASI_Mm02_00341954 predicted 1139
9 SASI_Mm02_00341955 predicted 473
10 SASI_Mm02_00341956 predicted 623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146238
VALIDATED
GEMIN8 MISSION shRNA Bacterial Glycerol Stock
gem (nuclear organelle) associated protein 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146238.2-1235s1c1
Sequence:CCGGCGTGTCATTTATTCCTACATTCTCGAGAATGTAGGAATAAATGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146238.2-785s1c1
Sequence:CCGGGCAGAGATGAAGCGCTTATATCTCGAGATATAAGCGCTTCATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180526    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146238.2-1756s1c1
Sequence:CCGGGCTCTATAAGACCTGAGAGTACTCGAGTACTCTCAGGTCTTATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146238.3-1389s21c1
Sequence:CCGGTGAGCTTCTGTCCACGTATTTCTCGAGAAATACGTGGACAGAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146238.3-138s21c1
Sequence:CCGGTGGTATTCTCACCCAGTATATCTCGAGATATACTGGGTGAGAATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146238.3-689s21c1
Sequence:CCGGAGCAGAGATGAAGCGCTTATACTCGAGTATAAGCGCTTCATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146238.3-139s1c1
Sequence:CCGGGGTATTCTCACCCAGTATATGCTCGAGCATATACTGGGTGAGAATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146238.3-223s21c1
Sequence:CCGGGAAAGTTCAGGGATTCCTATTCTCGAGAATAGGAATCCCTGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146238.3-485s21c1
Sequence:CCGGAGAGTGCGACCTGAGCAATATCTCGAGATATTGCTCAGGTCGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146238
VALIDATED
GEMIN8 MISSION shRNA shRNA Plasmid DNA
gem (nuclear organelle) associated protein 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146238.2-1235s1c1
Sequence:CCGGCGTGTCATTTATTCCTACATTCTCGAGAATGTAGGAATAAATGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146238.2-785s1c1
Sequence:CCGGGCAGAGATGAAGCGCTTATATCTCGAGATATAAGCGCTTCATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180526    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146238.2-1756s1c1
Sequence:CCGGGCTCTATAAGACCTGAGAGTACTCGAGTACTCTCAGGTCTTATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146238.3-1389s21c1
Sequence:CCGGTGAGCTTCTGTCCACGTATTTCTCGAGAAATACGTGGACAGAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146238.3-138s21c1
Sequence:CCGGTGGTATTCTCACCCAGTATATCTCGAGATATACTGGGTGAGAATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146238.3-689s21c1
Sequence:CCGGAGCAGAGATGAAGCGCTTATACTCGAGTATAAGCGCTTCATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146238.3-139s1c1
Sequence:CCGGGGTATTCTCACCCAGTATATGCTCGAGCATATACTGGGTGAGAATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146238.3-223s21c1
Sequence:CCGGGAAAGTTCAGGGATTCCTATTCTCGAGAATAGGAATCCCTGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146238.3-485s21c1
Sequence:CCGGAGAGTGCGACCTGAGCAATATCTCGAGATATTGCTCAGGTCGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146238
VALIDATED
GEMIN8 MISSION shRNA Lentiviral Transduction Particles
gem (nuclear organelle) associated protein 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146238.2-1235s1c1
Sequence:CCGGCGTGTCATTTATTCCTACATTCTCGAGAATGTAGGAATAAATGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146238.2-785s1c1
Sequence:CCGGGCAGAGATGAAGCGCTTATATCTCGAGATATAAGCGCTTCATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180526    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146238.2-1756s1c1
Sequence:CCGGGCTCTATAAGACCTGAGAGTACTCGAGTACTCTCAGGTCTTATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146238.3-1389s21c1
Sequence:CCGGTGAGCTTCTGTCCACGTATTTCTCGAGAAATACGTGGACAGAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146238.3-138s21c1
Sequence:CCGGTGGTATTCTCACCCAGTATATCTCGAGATATACTGGGTGAGAATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146238.3-689s21c1
Sequence:CCGGAGCAGAGATGAAGCGCTTATACTCGAGTATAAGCGCTTCATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146238.3-139s1c1
Sequence:CCGGGGTATTCTCACCCAGTATATGCTCGAGCATATACTGGGTGAGAATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146238.3-223s21c1
Sequence:CCGGGAAAGTTCAGGGATTCCTATTCTCGAGAATAGGAATCCCTGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146238.3-485s21c1
Sequence:CCGGAGAGTGCGACCTGAGCAATATCTCGAGATATTGCTCAGGTCGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017856
VALIDATED
GEMIN8 MISSION shRNA Bacterial Glycerol Stock
gem (nuclear organelle) associated protein 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017856.1-537s1c1
Sequence:CCGGCCTCAGTCCTTCTATGACCATCTCGAGATGGTCATAGAAGGACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017856.1-693s1c1
Sequence:CCGGGAGTCAGATGCAGAGGTAGAACTCGAGTTCTACCTCTGCATCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017856.2-2774s21c1
Sequence:CCGGCATCAGCCCTGGGTGCTTATTCTCGAGAATAAGCACCCAGGGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017856.2-492s21c1
Sequence:CCGGTCAATCTTCCATGGTACTTACCTCGAGGTAAGTACCATGGAAGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017856.2-528s21c1
Sequence:CCGGCCCAAAGCTCTTACGATAATGCTCGAGCATTATCGTAAGAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017856.2-386s21c1
Sequence:CCGGTGGTATTCTCATCCGGTATATCTCGAGATATACCGGATGAGAATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017856.2-733s21c1
Sequence:CCGGAGAATGTGACCTGAGCAATATCTCGAGATATTGCTCAGGTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017856
VALIDATED
GEMIN8 MISSION shRNA shRNA Plasmid DNA
gem (nuclear organelle) associated protein 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017856.1-537s1c1
Sequence:CCGGCCTCAGTCCTTCTATGACCATCTCGAGATGGTCATAGAAGGACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017856.1-693s1c1
Sequence:CCGGGAGTCAGATGCAGAGGTAGAACTCGAGTTCTACCTCTGCATCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017856.2-2774s21c1
Sequence:CCGGCATCAGCCCTGGGTGCTTATTCTCGAGAATAAGCACCCAGGGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017856.2-492s21c1
Sequence:CCGGTCAATCTTCCATGGTACTTACCTCGAGGTAAGTACCATGGAAGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017856.2-528s21c1
Sequence:CCGGCCCAAAGCTCTTACGATAATGCTCGAGCATTATCGTAAGAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017856.2-386s21c1
Sequence:CCGGTGGTATTCTCATCCGGTATATCTCGAGATATACCGGATGAGAATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017856.2-733s21c1
Sequence:CCGGAGAATGTGACCTGAGCAATATCTCGAGATATTGCTCAGGTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017856
VALIDATED
GEMIN8 MISSION shRNA Lentiviral Transduction Particles
gem (nuclear organelle) associated protein 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017856.1-537s1c1
Sequence:CCGGCCTCAGTCCTTCTATGACCATCTCGAGATGGTCATAGAAGGACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017856.1-693s1c1
Sequence:CCGGGAGTCAGATGCAGAGGTAGAACTCGAGTTCTACCTCTGCATCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017856.2-2774s21c1
Sequence:CCGGCATCAGCCCTGGGTGCTTATTCTCGAGAATAAGCACCCAGGGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017856.2-492s21c1
Sequence:CCGGTCAATCTTCCATGGTACTTACCTCGAGGTAAGTACCATGGAAGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017856.2-528s21c1
Sequence:CCGGCCCAAAGCTCTTACGATAATGCTCGAGCATTATCGTAAGAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017856.2-386s21c1
Sequence:CCGGTGGTATTCTCATCCGGTATATCTCGAGATATACCGGATGAGAATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017856.2-733s21c1
Sequence:CCGGAGAATGTGACCTGAGCAATATCTCGAGATATTGCTCAGGTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks