EMAIL THIS PAGE TO A FRIEND

GEN1

GEN1 Holliday junction 5' flap endonuclease

50 Gene Product Result for
Synonyms: Gen
UniProtKB ID: Q17RS7, Q17RS9, Q6ZN37
Gene ID:
Mouse(209334) Gen homolog 1, endonuclease (Drosophila)
Rat(298884) GEN1 Holliday junction 5' flap endonuclease
chicken(421951) Gen endonuclease homolog 1 (Drosophila)
dog(482980) Gen endonuclease homolog 1 (Drosophila)
cow(785690) Gen homolog 1, endonuclease (Drosophila)
Horse(100072048) Gen endonuclease homolog 1 (Drosophila)
domestic cat(101082559) Gen endonuclease homolog 1 (Drosophila)
sheep(101123280) Gen endonuclease homolog 1 (Drosophila)
Domestic Rabbit(100355273) Gen endonuclease homolog 1 (Drosophila)
naked mole-rat(101716898) GEN1 Holliday junction 5' flap endonuclease
domestic guinea pig(100721538) GEN1 Holliday junction 5' flap endonuclease
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182625 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177331 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177331 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177331 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182625 Rosetta Predictions human pricing
NM_001106717 Rosetta Predictions rat pricing
NM_177331 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236131 predicted 2045
2 SASI_Hs01_00236132 predicted 1902
3 SASI_Hs01_00236133 predicted 820
4 SASI_Hs01_00236134 predicted 2116
5 SASI_Hs01_00236135 predicted 2351
6 SASI_Hs01_00236137 predicted 2755
7 SASI_Hs01_00236138 predicted 878
8 SASI_Hs02_00370771 predicted 2441
9 SASI_Hs01_00236139 predicted 601
10 SASI_Hs01_00236140 predicted 1807
11 SASI_Hs01_00236136 predicted 2394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221698 predicted 1908
2 SASI_Rn02_00221699 predicted 2475
3 SASI_Rn02_00221700 predicted 573
4 SASI_Rn02_00221701 predicted 2946
5 SASI_Rn02_00221702 predicted 2913
6 SASI_Rn02_00221703 predicted 2321
7 SASI_Rn02_00221704 predicted 2070
8 SASI_Rn02_00221705 predicted 1885
9 SASI_Rn02_00221706 predicted 1408
10 SASI_Rn02_00221707 predicted 2744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347436 predicted 2130
2 SASI_Mm02_00347437 predicted 558
3 SASI_Mm02_00347438 predicted 2043
4 SASI_Mm02_00347439 predicted 1829
5 SASI_Mm02_00347440 predicted 261
6 SASI_Mm02_00347441 predicted 2553
7 SASI_Mm02_00347442 predicted 1130
8 SASI_Mm02_00347443 predicted 2955
9 SASI_Mm02_00347444 predicted 3025
10 SASI_Mm02_00347445 predicted 2520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182625
VALIDATED
GEN1 MISSION shRNA Bacterial Glycerol Stock
GEN1 Holliday junction 5' flap endonuclease
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182625.3-821s21c1
Sequence:CCGGCCACAACTGCTAGTCACTAAACTCGAGTTTAGTGACTAGCAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182625.3-2323s21c1
Sequence:CCGGCAATACTTCTGTCCCTTATTCCTCGAGGAATAAGGGACAGAAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182625.3-881s21c1
Sequence:CCGGCCTAAGGATCATGAACGTAATCTCGAGATTACGTTCATGATCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182625.3-3243s21c1
Sequence:CCGGCTCAGTGTGAAGATACCTTTACTCGAGTAAAGGTATCTTCACACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182625.3-2089s21c1
Sequence:CCGGGCCTTTAAAGGAACGAATATTCTCGAGAATATTCGTTCCTTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182625.1-412s1c1
Sequence:CCGGCCTGAACATTATGCTATGGAACTCGAGTTCCATAGCATAATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182625.1-1445s1c1
Sequence:CCGGCCTGCAATGTTAGACCACCAACTCGAGTTGGTGGTCTAACATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182625.1-1572s1c1
Sequence:CCGGCCCAGTGTTTGGGAAAGCTAACTCGAGTTAGCTTTCCCAAACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_182625.1-592s1c1
Sequence:CCGGCCAGATGAAGTAATGAGCTTTCTCGAGAAAGCTCATTACTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182625
VALIDATED
GEN1 MISSION shRNA shRNA Plasmid DNA
GEN1 Holliday junction 5' flap endonuclease
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182625.3-821s21c1
Sequence:CCGGCCACAACTGCTAGTCACTAAACTCGAGTTTAGTGACTAGCAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182625.3-2323s21c1
Sequence:CCGGCAATACTTCTGTCCCTTATTCCTCGAGGAATAAGGGACAGAAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182625.3-881s21c1
Sequence:CCGGCCTAAGGATCATGAACGTAATCTCGAGATTACGTTCATGATCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182625.3-3243s21c1
Sequence:CCGGCTCAGTGTGAAGATACCTTTACTCGAGTAAAGGTATCTTCACACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182625.3-2089s21c1
Sequence:CCGGGCCTTTAAAGGAACGAATATTCTCGAGAATATTCGTTCCTTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182625.1-412s1c1
Sequence:CCGGCCTGAACATTATGCTATGGAACTCGAGTTCCATAGCATAATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182625.1-1445s1c1
Sequence:CCGGCCTGCAATGTTAGACCACCAACTCGAGTTGGTGGTCTAACATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182625.1-1572s1c1
Sequence:CCGGCCCAGTGTTTGGGAAAGCTAACTCGAGTTAGCTTTCCCAAACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_182625.1-592s1c1
Sequence:CCGGCCAGATGAAGTAATGAGCTTTCTCGAGAAAGCTCATTACTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182625
VALIDATED
GEN1 MISSION shRNA Lentiviral Transduction Particles
GEN1 Holliday junction 5' flap endonuclease
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182625.3-821s21c1
Sequence:CCGGCCACAACTGCTAGTCACTAAACTCGAGTTTAGTGACTAGCAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182625.3-2323s21c1
Sequence:CCGGCAATACTTCTGTCCCTTATTCCTCGAGGAATAAGGGACAGAAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182625.3-881s21c1
Sequence:CCGGCCTAAGGATCATGAACGTAATCTCGAGATTACGTTCATGATCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182625.3-3243s21c1
Sequence:CCGGCTCAGTGTGAAGATACCTTTACTCGAGTAAAGGTATCTTCACACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182625.3-2089s21c1
Sequence:CCGGGCCTTTAAAGGAACGAATATTCTCGAGAATATTCGTTCCTTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182625.1-412s1c1
Sequence:CCGGCCTGAACATTATGCTATGGAACTCGAGTTCCATAGCATAATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182625.1-1445s1c1
Sequence:CCGGCCTGCAATGTTAGACCACCAACTCGAGTTGGTGGTCTAACATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182625.1-1572s1c1
Sequence:CCGGCCCAGTGTTTGGGAAAGCTAACTCGAGTTAGCTTTCCCAAACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_182625.1-592s1c1
Sequence:CCGGCCAGATGAAGTAATGAGCTTTCTCGAGAAAGCTCATTACTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177331
VALIDATED
GEN1 MISSION shRNA Bacterial Glycerol Stock
GEN1 Holliday junction 5' flap endonuclease
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216160    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177331.4-3074s1c1
Sequence:CCGGCAAGTATGGCTAATGCCTATACTCGAGTATAGGCATTAGCCATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177331.4-1872s1c1
Sequence:CCGGCCCAGAACTTTGGCTATAAAGCTCGAGCTTTATAGCCAAAGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177331.4-1123s21c1
Sequence:CCGGGGCATCAGACAGACCATAATACTCGAGTATTATGGTCTGTCTGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177331.4-1043s21c1
Sequence:CCGGTGAACGTAATGGATGCATATTCTCGAGAATATGCATCCATTACGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177331.4-3076s21c1
Sequence:CCGGAGTATGGCTAATGCCTATAATCTCGAGATTATAGGCATTAGCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177331.4-760s21c1
Sequence:CCGGATGTTGACTGTTACACGATATCTCGAGATATCGTGTAACAGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177331.4-1871s21c1
Sequence:CCGGTCCCAGAACTTTGGCTATAAACTCGAGTTTATAGCCAAAGTTCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177331.3-693s1c1
Sequence:CCGGGCCCAGACTGTTTACAGAAATCTCGAGATTTCTGTAAACAGTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177331.3-2299s1c1
Sequence:CCGGGCTCTTGTATTGCTTACAGTACTCGAGTACTGTAAGCAATACAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177331
VALIDATED
GEN1 MISSION shRNA shRNA Plasmid DNA
GEN1 Holliday junction 5' flap endonuclease
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216160    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177331.4-3074s1c1
Sequence:CCGGCAAGTATGGCTAATGCCTATACTCGAGTATAGGCATTAGCCATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177331.4-1872s1c1
Sequence:CCGGCCCAGAACTTTGGCTATAAAGCTCGAGCTTTATAGCCAAAGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177331.4-1123s21c1
Sequence:CCGGGGCATCAGACAGACCATAATACTCGAGTATTATGGTCTGTCTGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177331.4-1043s21c1
Sequence:CCGGTGAACGTAATGGATGCATATTCTCGAGAATATGCATCCATTACGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177331.4-3076s21c1
Sequence:CCGGAGTATGGCTAATGCCTATAATCTCGAGATTATAGGCATTAGCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177331.4-760s21c1
Sequence:CCGGATGTTGACTGTTACACGATATCTCGAGATATCGTGTAACAGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177331.4-1871s21c1
Sequence:CCGGTCCCAGAACTTTGGCTATAAACTCGAGTTTATAGCCAAAGTTCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177331.3-693s1c1
Sequence:CCGGGCCCAGACTGTTTACAGAAATCTCGAGATTTCTGTAAACAGTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177331.3-2299s1c1
Sequence:CCGGGCTCTTGTATTGCTTACAGTACTCGAGTACTGTAAGCAATACAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177331
VALIDATED
GEN1 MISSION shRNA Lentiviral Transduction Particles
GEN1 Holliday junction 5' flap endonuclease
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216160    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177331.4-3074s1c1
Sequence:CCGGCAAGTATGGCTAATGCCTATACTCGAGTATAGGCATTAGCCATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177331.4-1872s1c1
Sequence:CCGGCCCAGAACTTTGGCTATAAAGCTCGAGCTTTATAGCCAAAGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177331.4-1123s21c1
Sequence:CCGGGGCATCAGACAGACCATAATACTCGAGTATTATGGTCTGTCTGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177331.4-1043s21c1
Sequence:CCGGTGAACGTAATGGATGCATATTCTCGAGAATATGCATCCATTACGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177331.4-3076s21c1
Sequence:CCGGAGTATGGCTAATGCCTATAATCTCGAGATTATAGGCATTAGCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177331.4-760s21c1
Sequence:CCGGATGTTGACTGTTACACGATATCTCGAGATATCGTGTAACAGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177331.4-1871s21c1
Sequence:CCGGTCCCAGAACTTTGGCTATAAACTCGAGTTTATAGCCAAAGTTCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177331.3-693s1c1
Sequence:CCGGGCCCAGACTGTTTACAGAAATCTCGAGATTTCTGTAAACAGTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177331.3-2299s1c1
Sequence:CCGGGCTCTTGTATTGCTTACAGTACTCGAGTACTGTAAGCAATACAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks