EMAIL THIS PAGE TO A FRIEND

GET4

golgi to ER traffic protein 4 homolog (S. cerevisiae)

70 Gene Product Result for
Synonyms: C7orf20 CEE TRC35
UniProtKB ID: Q7L5D6, A4D2Q1, B3KNC7, Q9UFC9, Q9Y309
Gene ID:
Mouse(67604) golgi to ER traffic protein 4 homolog (S. cerevisiae)
Rat(288518) golgi to ER traffic protein 4 homolog (S. cerevisiae)
Zebrafish(796309) golgi to ER traffic protein 4 homolog (S. cerevisiae)
cow(618954) golgi to ER traffic protein 4 homolog (S. cerevisiae)
domestic cat(101088042) golgi to ER traffic protein 4 homolog (S. cerevisiae)
dog(491599) golgi to ER traffic protein 4 homolog (S. cerevisiae)
chicken(416450) golgi to ER traffic protein 4 homolog (S. cerevisiae)
sheep(101115424) golgi to ER traffic protein 4 homolog (S. cerevisiae)
domestic guinea pig(100734815) golgi to ER traffic protein 4 homolog (S. cerevisiae)
naked mole-rat(101701784) golgi to ER traffic protein 4 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015949 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015949 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015949 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026269 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026269 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026269 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015949 Rosetta Predictions human pricing
XM_001074468 Rosetta Predictions rat pricing
XM_213726 Rosetta Predictions rat pricing
NM_026269 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153734 predicted 687
2 SASI_Hs01_00153735 predicted 828
3 SASI_Hs01_00153736 predicted 615
4 SASI_Hs01_00153737 predicted 797
5 SASI_Hs01_00153738 predicted 902
6 SASI_Hs01_00153739 predicted 680
7 SASI_Hs01_00153740 predicted 1306
8 SASI_Hs01_00153741 predicted 562
9 SASI_Hs01_00153742 predicted 742
10 SASI_Hs01_00153743 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074468 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346358 predicted 805
2 SASI_Rn02_00346359 predicted 568
3 SASI_Rn02_00346360 predicted 979
4 SASI_Rn02_00346361 predicted 987
5 SASI_Rn02_00346362 predicted 873
6 SASI_Rn02_00346363 predicted 940
7 SASI_Rn02_00346364 predicted 1236
8 SASI_Rn02_00346365 predicted 1416
9 SASI_Rn02_00346366 predicted 1078
10 SASI_Rn02_00346367 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213726 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374856 predicted 805
2 SASI_Rn02_00374857 predicted 572
3 SASI_Rn02_00374858 predicted 979
4 SASI_Rn02_00374859 predicted 984
5 SASI_Rn02_00374860 predicted 869
6 SASI_Rn02_00374861 predicted 940
7 SASI_Rn02_00374862 predicted 1238
8 SASI_Rn02_00374863 predicted 1415
9 SASI_Rn02_00374864 predicted 1077
10 SASI_Rn02_00374865 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110277 predicted 420
2 SASI_Mm01_00110278 predicted 431
3 SASI_Mm01_00110279 predicted 648
4 SASI_Mm01_00110280 predicted 1263
5 SASI_Mm02_00329959 predicted 1222
6 SASI_Mm01_00110281 predicted 1282
7 SASI_Mm01_00110282 predicted 497
8 SASI_Mm01_00110283 predicted 711
9 SASI_Mm01_00110284 predicted 929
10 SASI_Mm01_00110285 predicted 1251
11 SASI_Mm01_00110286 predicted 408
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015949
GET4 MISSION shRNA Bacterial Glycerol Stock
golgi to ER traffic protein 4 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015949.2-688s1c1
Sequence:CCGGCCGTGCTACAGTTTCTCTGTTCTCGAGAACAGAGAAACTGTAGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015949.2-1783s1c1
Sequence:CCGGCGTCTCTTTCATAACGCAATACTCGAGTATTGCGTTATGAAAGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015949.2-689s1c1
Sequence:CCGGCGTGCTACAGTTTCTCTGTTTCTCGAGAAACAGAGAAACTGTAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163890    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015949.2-1782s1c1
Sequence:CCGGCCGTCTCTTTCATAACGCAATCTCGAGATTGCGTTATGAAAGAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015949.2-233s1c1
Sequence:CCGGGACCCTGTTCTTCAGGTACATCTCGAGATGTACCTGAAGAACAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015949.2-922s21c1
Sequence:CCGGACCGCATAGGACAGCTGTTCTCTCGAGAGAACAGCTGTCCTATGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015949.2-728s21c1
Sequence:CCGGATCGGTGGTCTTCACGACGTACTCGAGTACGTCGTGAAGACCACCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204321    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015949.2-1304s1c1
Sequence:CCGGCCCGAGATTGACCCACAATAACTCGAGTTATTGTGGGTCAATCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015949.2-620s21c1
Sequence:CCGGCAACATGCTGGTGGAGTATTCCTCGAGGAATACTCCACCAGCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015949.2-793s21c1
Sequence:CCGGAGCCGCTGCTTAACTTCATCTCTCGAGAGATGAAGTTAAGCAGCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015949
GET4 MISSION shRNA shRNA Plasmid DNA
golgi to ER traffic protein 4 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015949.2-688s1c1
Sequence:CCGGCCGTGCTACAGTTTCTCTGTTCTCGAGAACAGAGAAACTGTAGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015949.2-1783s1c1
Sequence:CCGGCGTCTCTTTCATAACGCAATACTCGAGTATTGCGTTATGAAAGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015949.2-689s1c1
Sequence:CCGGCGTGCTACAGTTTCTCTGTTTCTCGAGAAACAGAGAAACTGTAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163890    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015949.2-1782s1c1
Sequence:CCGGCCGTCTCTTTCATAACGCAATCTCGAGATTGCGTTATGAAAGAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015949.2-233s1c1
Sequence:CCGGGACCCTGTTCTTCAGGTACATCTCGAGATGTACCTGAAGAACAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015949.2-922s21c1
Sequence:CCGGACCGCATAGGACAGCTGTTCTCTCGAGAGAACAGCTGTCCTATGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015949.2-728s21c1
Sequence:CCGGATCGGTGGTCTTCACGACGTACTCGAGTACGTCGTGAAGACCACCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204321    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015949.2-1304s1c1
Sequence:CCGGCCCGAGATTGACCCACAATAACTCGAGTTATTGTGGGTCAATCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015949.2-620s21c1
Sequence:CCGGCAACATGCTGGTGGAGTATTCCTCGAGGAATACTCCACCAGCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015949.2-793s21c1
Sequence:CCGGAGCCGCTGCTTAACTTCATCTCTCGAGAGATGAAGTTAAGCAGCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015949
GET4 MISSION shRNA Lentiviral Transduction Particles
golgi to ER traffic protein 4 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015949.2-688s1c1
Sequence:CCGGCCGTGCTACAGTTTCTCTGTTCTCGAGAACAGAGAAACTGTAGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015949.2-1783s1c1
Sequence:CCGGCGTCTCTTTCATAACGCAATACTCGAGTATTGCGTTATGAAAGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015949.2-689s1c1
Sequence:CCGGCGTGCTACAGTTTCTCTGTTTCTCGAGAAACAGAGAAACTGTAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163890    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015949.2-1782s1c1
Sequence:CCGGCCGTCTCTTTCATAACGCAATCTCGAGATTGCGTTATGAAAGAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015949.2-233s1c1
Sequence:CCGGGACCCTGTTCTTCAGGTACATCTCGAGATGTACCTGAAGAACAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015949.2-922s21c1
Sequence:CCGGACCGCATAGGACAGCTGTTCTCTCGAGAGAACAGCTGTCCTATGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015949.2-728s21c1
Sequence:CCGGATCGGTGGTCTTCACGACGTACTCGAGTACGTCGTGAAGACCACCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204321    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015949.2-1304s1c1
Sequence:CCGGCCCGAGATTGACCCACAATAACTCGAGTTATTGTGGGTCAATCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015949.2-620s21c1
Sequence:CCGGCAACATGCTGGTGGAGTATTCCTCGAGGAATACTCCACCAGCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015949.2-793s21c1
Sequence:CCGGAGCCGCTGCTTAACTTCATCTCTCGAGAGATGAAGTTAAGCAGCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026269
VALIDATED
GET4 MISSION shRNA Bacterial Glycerol Stock
golgi to ER traffic protein 4 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026269.1-1872s1c1
Sequence:CCGGCCACGCTACCAGTCTGATTATCTCGAGATAATCAGACTGGTAGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026269.1-282s1c1
Sequence:CCGGGCTTATGTACTCAGGAGCATTCTCGAGAATGCTCCTGAGTACATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026269.1-540s1c1
Sequence:CCGGCCTCACATTATGGAAAGAGCACTCGAGTGCTCTTTCCATAATGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026269.1-680s21c1
Sequence:CCGGCTCAGGCTGTGCTACAGTTTCCTCGAGGAAACTGTAGCACAGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026269.1-530s21c1
Sequence:CCGGAGCTGCTGGCCCTCACATTATCTCGAGATAATGTGAGGGCCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026269.1-569s21c1
Sequence:CCGGGTGAGTCTCGGTATCACTTTCCTCGAGGAAAGTGATACCGAGACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026269.1-424s21c1
Sequence:CCGGTTCAGTTTGATGGATCCAAATCTCGAGATTTGGATCCATCAAACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026269.1-719s21c1
Sequence:CCGGACAGTGCACTGGTGGTCTTTACTCGAGTAAAGACCACCAGTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026269
VALIDATED
GET4 MISSION shRNA shRNA Plasmid DNA
golgi to ER traffic protein 4 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026269.1-1872s1c1
Sequence:CCGGCCACGCTACCAGTCTGATTATCTCGAGATAATCAGACTGGTAGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026269.1-282s1c1
Sequence:CCGGGCTTATGTACTCAGGAGCATTCTCGAGAATGCTCCTGAGTACATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026269.1-540s1c1
Sequence:CCGGCCTCACATTATGGAAAGAGCACTCGAGTGCTCTTTCCATAATGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026269.1-680s21c1
Sequence:CCGGCTCAGGCTGTGCTACAGTTTCCTCGAGGAAACTGTAGCACAGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026269.1-530s21c1
Sequence:CCGGAGCTGCTGGCCCTCACATTATCTCGAGATAATGTGAGGGCCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026269.1-569s21c1
Sequence:CCGGGTGAGTCTCGGTATCACTTTCCTCGAGGAAAGTGATACCGAGACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026269.1-424s21c1
Sequence:CCGGTTCAGTTTGATGGATCCAAATCTCGAGATTTGGATCCATCAAACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026269.1-719s21c1
Sequence:CCGGACAGTGCACTGGTGGTCTTTACTCGAGTAAAGACCACCAGTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026269
VALIDATED
GET4 MISSION shRNA Lentiviral Transduction Particles
golgi to ER traffic protein 4 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026269.1-1872s1c1
Sequence:CCGGCCACGCTACCAGTCTGATTATCTCGAGATAATCAGACTGGTAGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026269.1-282s1c1
Sequence:CCGGGCTTATGTACTCAGGAGCATTCTCGAGAATGCTCCTGAGTACATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026269.1-540s1c1
Sequence:CCGGCCTCACATTATGGAAAGAGCACTCGAGTGCTCTTTCCATAATGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026269.1-680s21c1
Sequence:CCGGCTCAGGCTGTGCTACAGTTTCCTCGAGGAAACTGTAGCACAGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026269.1-530s21c1
Sequence:CCGGAGCTGCTGGCCCTCACATTATCTCGAGATAATGTGAGGGCCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026269.1-569s21c1
Sequence:CCGGGTGAGTCTCGGTATCACTTTCCTCGAGGAAAGTGATACCGAGACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026269.1-424s21c1
Sequence:CCGGTTCAGTTTGATGGATCCAAATCTCGAGATTTGGATCCATCAAACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026269.1-719s21c1
Sequence:CCGGACAGTGCACTGGTGGTCTTTACTCGAGTAAAGACCACCAGTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks