EMAIL THIS PAGE TO A FRIEND

GFAP

glial fibrillary acidic protein

266 Gene Product Result for
Gene ID:
Human(2670) Summary: This gene encodes one of the major intermediate filament proteins of mature astrocytes. It is used as a marker to distinguish astrocytes from other glial cells during development. Mutations in this gene cause Alexander disease, a rare disorder of astrocytes in the central nervous system. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
Mouse(14580) glial fibrillary acidic protein
Rat(24387) glial fibrillary acidic protein
Zebrafish(30646) glial fibrillary acidic protein
dog(480495) glial fibrillary acidic protein
Horse(100033970) glial fibrillary acidic protein
domestic cat(101081938) glial fibrillary acidic protein
chicken(419969) glial fibrillary acidic protein
cow(281189) glial fibrillary acidic protein
sheep(443220) glial fibrillary acidic protein
Domestic Rabbit(100352532) glial fibrillary acidic protein
naked mole-rat(101707892) glial fibrillary acidic protein
domestic guinea pig(100720409) glial fibrillary acidic protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500462 Anti-GFAP antibody produced in goat affinity isolated antibody, buffered aqueous solution rat
ELISA, immunohistochemistry, western blot pricing
SAB1405864 Anti-GFAP antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2702474 Anti-Gfap antibody produced in rabbit affinity isolated antibody zebrafish
western blot pricing
SAB2702475 Anti-Gfap antibody produced in rabbit affinity isolated antibody zebrafish
western blot pricing
SAB4300647 Anti-GFAP antibody produced in rabbit affinity isolated antibody rat, human
western blot pricing
HPA056030 Anti-GFAP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2107063 Anti-GFAP antibody produced in rabbit affinity isolated antibody rabbit, human, mouse, horse, sheep, guinea pig
ELISA, western blot pricing
HPA063513 Anti-GFAP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB5500113 Anti-GFAP antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP78, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB4501162 Anti-GFAP, N-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
G4546 Anti-Glial Fibrillary Acidic Protein antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse, rat
flow cytometry, immunohistochemistry, western blot pricing
G9269 Anti-Glial Fibrillary Acidic Protein antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, human
immunohistochemistry, microarray, western blot pricing
G6171 Anti-Glial Fibrillary Acidic Protein antibody, Mouse monoclonal clone G-A-5, purified from hybridoma cell culture rat, pig, human
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504305 Anti-phospho-GFAP (pSer38) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301552 Anti-phospho-GFAP (pSer38) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB5201113 Monoclonal Anti-Gfap - Alkaline Phosphatase antibody produced in mouse clone S206A-8, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201131 Monoclonal Anti-Gfap - Alkaline Phosphatase antibody produced in mouse clone S206B-9, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201114 Monoclonal Anti-Gfap - Apc antibody produced in mouse clone S206A-8, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201132 Monoclonal Anti-Gfap - Apc antibody produced in mouse clone S206B-9, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201105 Monoclonal Anti-Gfap - Atto 390 antibody produced in mouse clone S206A-8, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201123 Monoclonal Anti-Gfap - Atto 390 antibody produced in mouse clone S206B-9, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201106 Monoclonal Anti-Gfap - Atto 488 antibody produced in mouse clone S206A-8, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201124 Monoclonal Anti-Gfap - Atto 488 antibody produced in mouse clone S206B-9, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201107 Monoclonal Anti-Gfap - Atto 565 antibody produced in mouse clone S206A-8, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201125 Monoclonal Anti-Gfap - Atto 565 antibody produced in mouse clone S206B-9, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201108 Monoclonal Anti-Gfap - Atto 594 antibody produced in mouse clone S206A-8, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201126 Monoclonal Anti-Gfap - Atto 594 antibody produced in mouse clone S206B-9, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201109 Monoclonal Anti-Gfap - Atto 633 antibody produced in mouse clone S206A-8, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201127 Monoclonal Anti-Gfap - Atto 633 antibody produced in mouse clone S206B-9, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201110 Monoclonal Anti-Gfap - Atto 655 antibody produced in mouse clone S206A-8, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201128 Monoclonal Anti-Gfap - Atto 655 antibody produced in mouse clone S206B-9, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201111 Monoclonal Anti-Gfap - Atto 680 antibody produced in mouse clone S206A-8, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201129 Monoclonal Anti-Gfap - Atto 680 antibody produced in mouse clone S206B-9, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201112 Monoclonal Anti-Gfap - Atto 700 antibody produced in mouse clone S206A-8, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201130 Monoclonal Anti-Gfap - Atto 700 antibody produced in mouse clone S206B-9, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201115 Monoclonal Anti-Gfap - Biotin antibody produced in mouse clone S206A-8, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201133 Monoclonal Anti-Gfap - Biotin antibody produced in mouse clone S206B-9, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201116 Monoclonal Anti-Gfap - Fitc antibody produced in mouse clone S206A-8, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201134 Monoclonal Anti-Gfap - Fitc antibody produced in mouse clone S206B-9, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201117 Monoclonal Anti-Gfap - Hrp antibody produced in mouse clone S206A-8, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201135 Monoclonal Anti-Gfap - Hrp antibody produced in mouse clone S206B-9, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201118 Monoclonal Anti-Gfap - Pe/Atto 594 antibody produced in mouse clone S206A-8, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201136 Monoclonal Anti-Gfap - Pe/Atto 594 antibody produced in mouse clone S206B-9, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201119 Monoclonal Anti-Gfap - Percp antibody produced in mouse clone S206A-8, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201137 Monoclonal Anti-Gfap - Percp antibody produced in mouse clone S206B-9, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201120 Monoclonal Anti-Gfap - Rpe antibody produced in mouse clone S206A-8, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201138 Monoclonal Anti-Gfap - Rpe antibody produced in mouse clone S206B-9, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201121 Monoclonal Anti-Gfap - Streptavidin antibody produced in mouse clone S206A-8, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201139 Monoclonal Anti-Gfap - Streptavidin antibody produced in mouse clone S206B-9, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201104 Monoclonal Anti-Gfap antibody produced in mouse clone S206A-8, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB4100002 Monoclonal Anti-GFAP antibody produced in mouse clone GFAP-B4, hybridoma cell culture supernatant rat, human
immunocytochemistry, immunofluorescence, western blot pricing
AMAB91033 Monoclonal Anti-GFAP antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2713, purified immunoglobulin, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
SAB5201122 Monoclonal Anti-Gfap R416Wt antibody produced in mouse clone S206B-9, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
G3893 Monoclonal Anti-Glial Fibrillary Acidic Protein (GFAP) antibody produced in mouse clone G-A-5, ascites fluid human, pig, rat
immunohistochemistry, microarray pricing
C9205 Monoclonal Anti-Glial Fibrillary Acidic Protein (GFAP)−Cy3 antibody produced in mouse clone G-A-5, purified from hybridoma cell culture rat, pig, human
immunofluorescence pricing

ELISA

Product # Description Species Add to Cart
 
RAB1483 Human GFAP ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002055 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002055 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002055 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010277 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010277 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010277 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
MAB3402B Anti-GFAP Antibody, Biotin Conjugate | MAB3402B 100 µL, Anti-GFAP Antibody, Biotin Conjugate detects level of GFAP & has been published & validated for use in IH. pricing
MAB3402C3 Anti-GFAP Antibody, Cy3 Conjugate 100 µL, Anti-GFAP Antibody, Cy3 Conjugate is an antibody against GFAP for use in IC, IH. pricing
AB9598 Anti-Glial fibrillary acidic protein δ Antibody 100 µL, Anti-Glial fibrillary acidic protein δ Antibody is an antibody against Glial fibrillary acidic protein δ for use in WB, IH(P). pricing
AB5541 Anti-Glial Fibrillary Acidic Protein Antibody 50 µL, This Anti-Glial Fibrillary Acidic Protein Antibody is validated for use in IC, IH, IH(P), WB for the detection of GFAP. pricing
MAB5628 Anti-Glial Fibrillary Acidic Protein Antibody 100 µg, Detect Glial Fibrillary Acidic Protein using this Anti-Glial Fibrillary Acidic Protein Antibody validated for use in WB & IC. pricing
MAB3402 Anti-Glial Fibrillary Acidic Protein Antibody, clone GA5 40 µg, Anti-Glial Fibrillary Acidic Protein Antibody, clone GA5 is an antibody against Glial Fibrillary Acidic Protein for use in IC, IH, IH(P) & WB with more than 55 product citations. pricing
MAB360 Anti-Glial Fibrillary Acidic Protein Antibody, clone GA5 100 µL, Anti-Glial Fibrillary Acidic Protein Antibody, clone GA5 detects level of Glial Fibrillary Acidic Protein & has been published & validated for use in IC, IH, IH(P) & WB with more than 65 product citations. pricing
MAB3402X Anti-Glial Fibrillary Acidic Protein Antibody, clone GA5, Alexa Fluor® 488 100 µg, Detect Glial Fibrillary Acidic Protein using this Anti-Glial Fibrillary Acidic Protein Antibody, clone GA5, Alexa Fluor 488 validated for use in IC, IH. pricing
AB5804 Anti-Glial Fibrillary Acidic Protein (GFAP) Antibody 50 µL, Anti-Glial Fibrillary Acidic Protein (GFAP) Antibody is an antibody against Glial Fibrillary Acidic Protein (GFAP) for use in IC, IH, IH(P) with more than 65 product citations. pricing
AG230 Glial Fibrillary Acidic Protein, porcine 100 µg pricing
FCMAB257P Milli-Mark™Anti-Glial Fibrillary Acidic Protein-PE Antibody, clone GA5 100 tests, Milli-MarkAnti-Glial Fibrillary Acidic Protein-PE Antibody, clone GA5 detects level of Glial Fibrillary Acidic Protein & has been published & validated for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002055 Rosetta Predictions human pricing
NM_017009 Rosetta Predictions rat pricing
XM_579387 Rosetta Predictions rat pricing
NM_001131020 Rosetta Predictions mouse pricing
NM_010277 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227609 predicted 598
2 SASI_Hs01_00227611 predicted 1364
3 SASI_Hs01_00227612 predicted 1517
4 SASI_Hs01_00227613 predicted 1516
5 SASI_Hs01_00227614 predicted 1146
6 SASI_Hs01_00227615 predicted 748
7 SASI_Hs01_00227616 predicted 872
8 SASI_Hs01_00227617 predicted 1189
9 SASI_Hs02_00333098 predicted 1473
10 SASI_Hs01_00227618 predicted 207
11 SASI_Hs01_00227610 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261167 predicted 754
2 SASI_Rn01_00089964 predicted 1116
3 SASI_Rn02_00261168 predicted 826
4 SASI_Rn01_00089965 predicted 319
5 SASI_Rn02_00261169 predicted 595
6 SASI_Rn02_00261170 predicted 576
7 SASI_Rn01_00089968 predicted 1175
8 SASI_Rn02_00261171 predicted 319
9 SASI_Rn02_00261172 predicted 1127
10 SASI_Rn02_00261173 predicted 1757
11 SASI_Rn01_00089963 predicted 1377
12 SASI_Rn01_00089966 predicted 1615
13 SASI_Rn01_00089967 predicted 727
14 SASI_Rn01_00089969 predicted 1341
15 SASI_Rn01_00089970 predicted 1192
16 SASI_Rn01_00089971 predicted 1125
17 SASI_Rn01_00089972 predicted 1609
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579387 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00153327 predicted 479
2 SASI_Rn01_00153328 predicted 518
3 SASI_Rn01_00153329 predicted 437
4 SASI_Rn01_00153330 predicted 601
5 SASI_Rn01_00153331 predicted 598
6 SASI_Rn01_00153332 predicted 498
7 SASI_Rn01_00153333 predicted 515
8 SASI_Rn01_00153334 predicted 431
9 SASI_Rn01_00153335 predicted 462
10 SASI_Rn01_00153336 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001131020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311420 predicted 301
2 SASI_Mm02_00311421 predicted 773
3 SASI_Mm02_00311422 predicted 827
4 SASI_Mm02_00311423 predicted 659
5 SASI_Mm02_00311424 predicted 242
6 SASI_Mm02_00311425 predicted 273
7 SASI_Mm02_00311426 predicted 677
8 SASI_Mm02_00311427 predicted 665
9 SASI_Mm02_00311428 predicted 570
10 SASI_Mm02_00311429 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135513 predicted 307
2 SASI_Mm01_00135514 predicted 780
3 SASI_Mm01_00135515 predicted 828
4 SASI_Mm01_00135516 predicted 656
5 SASI_Mm02_00318203 predicted 237
6 SASI_Mm02_00318204 predicted 280
7 SASI_Mm01_00135518 predicted 682
8 SASI_Mm02_00318205 predicted 659
9 SASI_Mm01_00135520 predicted 574
10 SASI_Mm01_00135522 predicted 845
11 SASI_Mm01_00135517 predicted 1049
12 SASI_Mm01_00135519 predicted 215
13 SASI_Mm01_00135521 predicted 1049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002055
GFAP MISSION shRNA Bacterial Glycerol Stock
glial fibrillary acidic protein
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002055.3-1177s21c1
Sequence:CCGGGAGGAGAACCGGATCACCATTCTCGAGAATGGTGATCCGGTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002055.2-1226s1c1
Sequence:CCGGCAAGAGGAACATCGTGGTGAACTCGAGTTCACCACGATGTTCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002055.2-525s1c1
Sequence:CCGGGCCTATAGACAGGAAGCAGATCTCGAGATCTGCTTCCTGTCTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002055.2-1268s1c1
Sequence:CCGGAGAGGTCATTAAGGAGTCCAACTCGAGTTGGACTCCTTAATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002055.2-728s1c1
Sequence:CCGGCCGCACGCAGTATGAGGCAATCTCGAGATTGCCTCATACTGCGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002055.2-2622s1c1
Sequence:CCGGCCCTTCTTACTCACACACAAACTCGAGTTTGTGTGTGAGTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002055
GFAP MISSION shRNA shRNA Plasmid DNA
glial fibrillary acidic protein
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002055.3-1177s21c1
Sequence:CCGGGAGGAGAACCGGATCACCATTCTCGAGAATGGTGATCCGGTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002055.2-1226s1c1
Sequence:CCGGCAAGAGGAACATCGTGGTGAACTCGAGTTCACCACGATGTTCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002055.2-525s1c1
Sequence:CCGGGCCTATAGACAGGAAGCAGATCTCGAGATCTGCTTCCTGTCTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002055.2-1268s1c1
Sequence:CCGGAGAGGTCATTAAGGAGTCCAACTCGAGTTGGACTCCTTAATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002055.2-728s1c1
Sequence:CCGGCCGCACGCAGTATGAGGCAATCTCGAGATTGCCTCATACTGCGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002055.2-2622s1c1
Sequence:CCGGCCCTTCTTACTCACACACAAACTCGAGTTTGTGTGTGAGTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002055
GFAP MISSION shRNA Lentiviral Transduction Particles
glial fibrillary acidic protein
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002055.3-1177s21c1
Sequence:CCGGGAGGAGAACCGGATCACCATTCTCGAGAATGGTGATCCGGTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002055.2-1226s1c1
Sequence:CCGGCAAGAGGAACATCGTGGTGAACTCGAGTTCACCACGATGTTCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002055.2-525s1c1
Sequence:CCGGGCCTATAGACAGGAAGCAGATCTCGAGATCTGCTTCCTGTCTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002055.2-1268s1c1
Sequence:CCGGAGAGGTCATTAAGGAGTCCAACTCGAGTTGGACTCCTTAATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002055.2-728s1c1
Sequence:CCGGCCGCACGCAGTATGAGGCAATCTCGAGATTGCCTCATACTGCGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002055.2-2622s1c1
Sequence:CCGGCCCTTCTTACTCACACACAAACTCGAGTTTGTGTGTGAGTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010277
GFAP MISSION shRNA Bacterial Glycerol Stock
glial fibrillary acidic protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010277.3-910s21c1
Sequence:CCGGAGCACGAAGCTAACGACTATCCTCGAGGATAGTCGTTAGCTTCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010277.3-572s21c1
Sequence:CCGGGAACAACCTGGCTGCGTATAGCTCGAGCTATACGCAGCCAGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010277.3-1416s21c1
Sequence:CCGGGCCCAAAGCTTATCCTCAAATCTCGAGATTTGAGGATAAGCTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010277.1-660s1c1
Sequence:CCGGGAGAGAGATTCGCACTCAATACTCGAGTATTGAGTGCGAATCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010277.1-1006s1c1
Sequence:CCGGGATCTACTCAACGTTAAGCTACTCGAGTAGCTTAACGTTGAGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010277.1-192s1c1
Sequence:CCGGCTTTGCTAGCTACATCGAGAACTCGAGTTCTCGATGTAGCTAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010277.1-501s1c1
Sequence:CCGGTCGTGTGGATTTGGAGAGAAACTCGAGTTTCTCTCCAAATCCACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010277.1-718s1c1
Sequence:CCGGGAGTGGTATCGGTCTAAGTTTCTCGAGAAACTTAGACCGATACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010277
GFAP MISSION shRNA shRNA Plasmid DNA
glial fibrillary acidic protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010277.3-910s21c1
Sequence:CCGGAGCACGAAGCTAACGACTATCCTCGAGGATAGTCGTTAGCTTCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010277.3-572s21c1
Sequence:CCGGGAACAACCTGGCTGCGTATAGCTCGAGCTATACGCAGCCAGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010277.3-1416s21c1
Sequence:CCGGGCCCAAAGCTTATCCTCAAATCTCGAGATTTGAGGATAAGCTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010277.1-660s1c1
Sequence:CCGGGAGAGAGATTCGCACTCAATACTCGAGTATTGAGTGCGAATCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010277.1-1006s1c1
Sequence:CCGGGATCTACTCAACGTTAAGCTACTCGAGTAGCTTAACGTTGAGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010277.1-192s1c1
Sequence:CCGGCTTTGCTAGCTACATCGAGAACTCGAGTTCTCGATGTAGCTAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010277.1-501s1c1
Sequence:CCGGTCGTGTGGATTTGGAGAGAAACTCGAGTTTCTCTCCAAATCCACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010277.1-718s1c1
Sequence:CCGGGAGTGGTATCGGTCTAAGTTTCTCGAGAAACTTAGACCGATACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010277
GFAP MISSION shRNA Lentiviral Transduction Particles
glial fibrillary acidic protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010277.3-910s21c1
Sequence:CCGGAGCACGAAGCTAACGACTATCCTCGAGGATAGTCGTTAGCTTCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010277.3-572s21c1
Sequence:CCGGGAACAACCTGGCTGCGTATAGCTCGAGCTATACGCAGCCAGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010277.3-1416s21c1
Sequence:CCGGGCCCAAAGCTTATCCTCAAATCTCGAGATTTGAGGATAAGCTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010277.1-660s1c1
Sequence:CCGGGAGAGAGATTCGCACTCAATACTCGAGTATTGAGTGCGAATCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010277.1-1006s1c1
Sequence:CCGGGATCTACTCAACGTTAAGCTACTCGAGTAGCTTAACGTTGAGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010277.1-192s1c1
Sequence:CCGGCTTTGCTAGCTACATCGAGAACTCGAGTTCTCGATGTAGCTAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010277.1-501s1c1
Sequence:CCGGTCGTGTGGATTTGGAGAGAAACTCGAGTTTCTCTCCAAATCCACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010277.1-718s1c1
Sequence:CCGGGAGTGGTATCGGTCTAAGTTTCTCGAGAAACTTAGACCGATACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks