EMAIL THIS PAGE TO A FRIEND

GFER

growth factor, augmenter of liver regeneration

52 Gene Product Result for
Synonyms: ALR ERV1 HERV1 HPO HPO1 HPO2 HSS
UniProtKB ID: P55789, Q53YM6, Q8TAH6, Q9H290, Q9UK40
Gene ID:
Human(2671) Summary: The hepatotrophic factor designated augmenter of liver regeneration (ALR) is thought to be one of the factors responsible for the extraordinary regenerative capacity of mammalian liver. It has also been called hepatic regenerative stimulation substance (HSS). The gene resides on chromosome 16 in the interval containing the locus for polycystic kidney disease (PKD1). The putative gene product is 42% similar to the scERV1 protein of yeast. The yeast scERV1 gene had been found to be essential for oxidative phosphorylation, the maintenance of mitochondrial genomes, and the cell division cycle. The human gene is both the structural and functional homolog of the yeast scERV1 gene. [provided by RefSeq, Jul 2008]
Mouse(11692) growth factor, erv1 (S. cerevisiae)-like (augmenter of liver regeneration)
Rat(27100) growth factor, augmenter of liver regeneration
Zebrafish(560433) growth factor, augmenter of liver regeneration (ERV1 homolog, S. cerevisiae)
dog(479885) growth factor, augmenter of liver regeneration
cow(618423) growth factor, augmenter of liver regeneration
domestic cat(101082968) growth factor, augmenter of liver regeneration
chicken(416547) growth factor, augmenter of liver regeneration
domestic guinea pig(100730132) growth factor, augmenter of liver regeneration
naked mole-rat(101721514) growth factor, augmenter of liver regeneration
sheep(101114838) growth factor, augmenter of liver regeneration
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023040 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023040 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023040 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005262 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125251 MISSION® esiRNA esiRNA human GFER (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005262 Rosetta Predictions human pricing
NM_013222 Rosetta Predictions rat pricing
NM_023040 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158226 predicted 984
2 SASI_Hs01_00158227 predicted 447
3 SASI_Hs01_00158228 predicted 1072
4 SASI_Hs02_00339294 predicted 833
5 SASI_Hs01_00158230 predicted 619
6 SASI_Hs01_00158231 predicted 976
7 SASI_Hs01_00158233 predicted 665
8 SASI_Hs01_00158235 predicted 662
9 SASI_Hs02_00339295 predicted 1137
10 SASI_Hs02_00339296 predicted 999
11 SASI_Hs01_00158229 predicted 1194
12 SASI_Hs01_00158232 predicted 1116
13 SASI_Hs01_00158234 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043207 predicted 660
2 SASI_Rn02_00261089 predicted 979
3 SASI_Rn01_00043208 predicted 986
4 SASI_Rn01_00043209 predicted 678
5 SASI_Rn01_00043210 predicted 963
6 SASI_Rn01_00043211 predicted 444
7 SASI_Rn01_00043212 predicted 950
8 SASI_Rn01_00043213 predicted 406
9 SASI_Rn01_00043214 predicted 490
10 SASI_Rn01_00043215 predicted 530
11 SASI_Rn01_00043216 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023040 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156366 predicted 765
2 SASI_Mm01_00156367 predicted 894
3 SASI_Mm01_00156368 predicted 441
4 SASI_Mm01_00156369 predicted 956
5 SASI_Mm01_00156370 predicted 442
6 SASI_Mm01_00156371 predicted 777
7 SASI_Mm01_00156372 predicted 541
8 SASI_Mm01_00156373 predicted 817
9 SASI_Mm01_00156374 predicted 736
10 SASI_Mm01_00156375 predicted 985
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023040
VALIDATED
GFER MISSION shRNA Bacterial Glycerol Stock
growth factor, augmenter of liver regeneration
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023040.2-324s1c1
Sequence:CCGGCATCAAGTTTAGGGAGGACTGCTCGAGCAGTCCTCCCTAAACTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023040.2-1482s1c1
Sequence:CCGGCCCTTCATTTGGGACATAGTTCTCGAGAACTATGTCCCAAATGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023040.2-442s1c1
Sequence:CCGGGATATGGCCCAGTTCATACATCTCGAGATGTATGAACTGGGCCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023040.2-898s1c1
Sequence:CCGGGCTGGATTCAAATTCTTCAATCTCGAGATTGAAGAATTTGAATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023040.2-499s1c1
Sequence:CCGGGAAGACATAAGGAAGAGGATACTCGAGTATCCTCTTCCTTATGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023040.2-426s1c1
Sequence:CCGGGCCAGAACAACAACAGGATATCTCGAGATATCCTGTTGTTGTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023040.3-450s21c1
Sequence:CCGGGATATGGCCCAGTTCATACATCTCGAGATGTATGAACTGGGCCATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023040.3-507s21c1
Sequence:CCGGGAAGACATAAGGAAGAGGATACTCGAGTATCCTCTTCCTTATGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023040.3-434s21c1
Sequence:CCGGGCCAGAACAACAACAGGATATCTCGAGATATCCTGTTGTTGTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023040.3-735s21c1
Sequence:CCGGACAGCCTGATTGACGATTAAACTCGAGTTTAATCGTCAATCAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023040
VALIDATED
GFER MISSION shRNA shRNA Plasmid DNA
growth factor, augmenter of liver regeneration
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023040.2-324s1c1
Sequence:CCGGCATCAAGTTTAGGGAGGACTGCTCGAGCAGTCCTCCCTAAACTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023040.2-1482s1c1
Sequence:CCGGCCCTTCATTTGGGACATAGTTCTCGAGAACTATGTCCCAAATGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023040.2-442s1c1
Sequence:CCGGGATATGGCCCAGTTCATACATCTCGAGATGTATGAACTGGGCCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023040.2-898s1c1
Sequence:CCGGGCTGGATTCAAATTCTTCAATCTCGAGATTGAAGAATTTGAATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023040.2-499s1c1
Sequence:CCGGGAAGACATAAGGAAGAGGATACTCGAGTATCCTCTTCCTTATGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023040.2-426s1c1
Sequence:CCGGGCCAGAACAACAACAGGATATCTCGAGATATCCTGTTGTTGTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023040.3-450s21c1
Sequence:CCGGGATATGGCCCAGTTCATACATCTCGAGATGTATGAACTGGGCCATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023040.3-507s21c1
Sequence:CCGGGAAGACATAAGGAAGAGGATACTCGAGTATCCTCTTCCTTATGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023040.3-434s21c1
Sequence:CCGGGCCAGAACAACAACAGGATATCTCGAGATATCCTGTTGTTGTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023040.3-735s21c1
Sequence:CCGGACAGCCTGATTGACGATTAAACTCGAGTTTAATCGTCAATCAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023040
VALIDATED
GFER MISSION shRNA Lentiviral Transduction Particles
growth factor, augmenter of liver regeneration
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023040.2-324s1c1
Sequence:CCGGCATCAAGTTTAGGGAGGACTGCTCGAGCAGTCCTCCCTAAACTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023040.2-1482s1c1
Sequence:CCGGCCCTTCATTTGGGACATAGTTCTCGAGAACTATGTCCCAAATGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023040.2-442s1c1
Sequence:CCGGGATATGGCCCAGTTCATACATCTCGAGATGTATGAACTGGGCCATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023040.2-898s1c1
Sequence:CCGGGCTGGATTCAAATTCTTCAATCTCGAGATTGAAGAATTTGAATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023040.2-499s1c1
Sequence:CCGGGAAGACATAAGGAAGAGGATACTCGAGTATCCTCTTCCTTATGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023040.2-426s1c1
Sequence:CCGGGCCAGAACAACAACAGGATATCTCGAGATATCCTGTTGTTGTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023040.3-450s21c1
Sequence:CCGGGATATGGCCCAGTTCATACATCTCGAGATGTATGAACTGGGCCATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023040.3-507s21c1
Sequence:CCGGGAAGACATAAGGAAGAGGATACTCGAGTATCCTCTTCCTTATGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023040.3-434s21c1
Sequence:CCGGGCCAGAACAACAACAGGATATCTCGAGATATCCTGTTGTTGTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023040.3-735s21c1
Sequence:CCGGACAGCCTGATTGACGATTAAACTCGAGTTTAATCGTCAATCAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005262
GFER MISSION shRNA Bacterial Glycerol Stock
growth factor, augmenter of liver regeneration
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005262.1-299s1c1
Sequence:CCGGGCCCAGTTCATACATTTATTTCTCGAGAAATAAATGTATGAACTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005262.1-293s1c1
Sequence:CCGGGACATGGCCCAGTTCATACATCTCGAGATGTATGAACTGGGCCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005262.1-341s1c1
Sequence:CCGGGAGTGTGCTGAAGACCTAAGACTCGAGTCTTAGGTCTTCAGCACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005262.2-325s21c1
Sequence:CCGGGAAGCGGGACACCAAGTTTAGCTCGAGCTAAACTTGGTGTCCCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005262.2-500s21c1
Sequence:CCGGGAGTGTGCTGAAGACCTAAGACTCGAGTCTTAGGTCTTCAGCACACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005262.2-1956s21c1
Sequence:CCGGAGTGTGTCCTGTGGTCATAAACTCGAGTTTATGACCACAGGACACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005262.2-456s21c1
Sequence:CCGGTGGCCCAGTTCATACATTTATCTCGAGATAAATGTATGAACTGGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005262.2-293s21c1
Sequence:CCGGGTCGACTTCAAGACGTGGATGCTCGAGCATCCACGTCTTGAAGTCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005262
GFER MISSION shRNA shRNA Plasmid DNA
growth factor, augmenter of liver regeneration
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005262.1-299s1c1
Sequence:CCGGGCCCAGTTCATACATTTATTTCTCGAGAAATAAATGTATGAACTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005262.1-293s1c1
Sequence:CCGGGACATGGCCCAGTTCATACATCTCGAGATGTATGAACTGGGCCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005262.1-341s1c1
Sequence:CCGGGAGTGTGCTGAAGACCTAAGACTCGAGTCTTAGGTCTTCAGCACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005262.2-325s21c1
Sequence:CCGGGAAGCGGGACACCAAGTTTAGCTCGAGCTAAACTTGGTGTCCCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005262.2-500s21c1
Sequence:CCGGGAGTGTGCTGAAGACCTAAGACTCGAGTCTTAGGTCTTCAGCACACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005262.2-1956s21c1
Sequence:CCGGAGTGTGTCCTGTGGTCATAAACTCGAGTTTATGACCACAGGACACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005262.2-456s21c1
Sequence:CCGGTGGCCCAGTTCATACATTTATCTCGAGATAAATGTATGAACTGGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005262.2-293s21c1
Sequence:CCGGGTCGACTTCAAGACGTGGATGCTCGAGCATCCACGTCTTGAAGTCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005262
GFER MISSION shRNA Lentiviral Transduction Particles
growth factor, augmenter of liver regeneration
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005262.1-299s1c1
Sequence:CCGGGCCCAGTTCATACATTTATTTCTCGAGAAATAAATGTATGAACTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005262.1-293s1c1
Sequence:CCGGGACATGGCCCAGTTCATACATCTCGAGATGTATGAACTGGGCCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005262.1-341s1c1
Sequence:CCGGGAGTGTGCTGAAGACCTAAGACTCGAGTCTTAGGTCTTCAGCACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005262.2-325s21c1
Sequence:CCGGGAAGCGGGACACCAAGTTTAGCTCGAGCTAAACTTGGTGTCCCGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005262.2-500s21c1
Sequence:CCGGGAGTGTGCTGAAGACCTAAGACTCGAGTCTTAGGTCTTCAGCACACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005262.2-1956s21c1
Sequence:CCGGAGTGTGTCCTGTGGTCATAAACTCGAGTTTATGACCACAGGACACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005262.2-456s21c1
Sequence:CCGGTGGCCCAGTTCATACATTTATCTCGAGATAAATGTATGAACTGGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005262.2-293s21c1
Sequence:CCGGGTCGACTTCAAGACGTGGATGCTCGAGCATCCACGTCTTGAAGTCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)