EMAIL THIS PAGE TO A FRIEND

GFI1

growth factor independent 1 transcription repressor

97 Gene Product Result for
Synonyms: GFI-1 GFI1A SCN2 ZNF163
UniProtKB ID: Q99684, Q8N564
Gene ID:
Human(2672) Summary: This gene encodes a nuclear zinc finger protein that functions as a transcriptional repressor. This protein plays a role in diverse developmental contexts, including hematopoiesis and oncogenesis. It functions as part of a complex along with other cofactors to control histone modifications that lead to silencing of the target gene promoters. Mutations in this gene cause autosomal dominant severe congenital neutropenia, and also dominant nonimmune chronic idiopathic neutropenia of adults, which are heterogeneous hematopoietic disorders that cause predispositions to leukemias and infections. Multiple alternatively spliced variants, encoding the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(14581) growth factor independent 1
Rat(24388) growth factor independent 1 transcription repressor
chicken(429088) growth factor independent 1 transcription repressor
domestic cat(100127020) growth factor independent 1 transcription repressor
cow(100139952) growth factor independent 1 transcription repressor
dog(490156) growth factor independent 1 transcription repressor
sheep(101116880) growth factor independent 1 transcription repressor
naked mole-rat(101715410) growth factor independent 1 transcription repressor
domestic guinea pig(100716876) growth factor independent 1 transcription repressor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005263 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010278 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010278 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010278 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059361 MISSION® esiRNA esiRNA human GFI1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127215 Rosetta Predictions human pricing
NM_001127216 Rosetta Predictions human pricing
NM_005263 Rosetta Predictions human pricing
NM_012566 Rosetta Predictions rat pricing
NM_010278 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328817 predicted 1198
2 SASI_Hs02_00328818 predicted 1445
3 SASI_Hs02_00328819 predicted 1600
4 SASI_Hs02_00328820 predicted 1639
5 SASI_Hs02_00328821 predicted 1854
6 SASI_Hs02_00328822 predicted 1193
7 SASI_Hs02_00328823 predicted 1690
8 SASI_Hs02_00328824 predicted 1193
9 SASI_Hs02_00328825 predicted 1091
10 SASI_Hs02_00328826 predicted 1669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328827 predicted 1190
2 SASI_Hs02_00328828 predicted 1438
3 SASI_Hs02_00328829 predicted 1597
4 SASI_Hs02_00328830 predicted 1632
5 SASI_Hs02_00328831 predicted 1847
6 SASI_Hs02_00328832 predicted 1185
7 SASI_Hs02_00328833 predicted 1682
8 SASI_Hs02_00328834 predicted 1188
9 SASI_Hs02_00328835 predicted 1084
10 SASI_Hs02_00328836 predicted 1663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220246 predicted 1284
2 SASI_Hs02_00339297 predicted 1533
3 SASI_Hs01_00220248 predicted 1691
4 SASI_Hs01_00220249 predicted 1721
5 SASI_Hs01_00220250 predicted 1939
6 SASI_Hs01_00220251 predicted 1275
7 SASI_Hs01_00220252 predicted 1778
8 SASI_Hs01_00220253 predicted 1277
9 SASI_Hs01_00220255 predicted 1173
10 SASI_Hs02_00339298 predicted 1755
11 SASI_Hs01_00220247 predicted 1238
12 SASI_Hs01_00220254 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012566 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086698 predicted 987
2 SASI_Rn01_00086699 predicted 1659
3 SASI_Rn01_00086700 predicted 1095
4 SASI_Rn02_00259678 predicted 1234
5 SASI_Rn01_00086702 predicted 907
6 SASI_Rn01_00086703 predicted 413
7 SASI_Rn01_00086704 predicted 750
8 SASI_Rn01_00086705 predicted 1558
9 SASI_Rn02_00259679 predicted 1514
10 SASI_Rn02_00259680 predicted 1765
11 SASI_Rn01_00086701 predicted 1116
12 SASI_Rn01_00086706 predicted 1312
13 SASI_Rn01_00086707 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318206 predicted 2230
2 SASI_Mm01_00113978 predicted 1481
3 SASI_Mm01_00113980 predicted 1551
4 SASI_Mm01_00113981 predicted 622
5 SASI_Mm01_00113984 predicted 1209
6 SASI_Mm01_00113983 predicted 2152
7 SASI_Mm01_00113985 predicted 1354
8 SASI_Mm01_00113987 predicted 1802
9 SASI_Mm02_00318207 predicted 1190
10 SASI_Mm01_00113986 predicted 1785
11 SASI_Mm01_00113979 predicted 1195
12 SASI_Mm01_00113982 predicted 1869
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005263
VALIDATED
GFI1 MISSION shRNA Bacterial Glycerol Stock
growth factor independent 1 transcription repressor
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005263.3-1175s21c1
Sequence:CCGGGAACGGAGCTTTGACTGTAAGCTCGAGCTTACAGTCAAAGCTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005263.1-2068s1c1
Sequence:CCGGGCCTATAAATCTTGGAGGAATCTCGAGATTCCTCCAAGATTTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_005263.1-334s1c1
Sequence:CCGGCCAGACTATTCCCTCCGTTTACTCGAGTAAACGGAGGGAATAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_005263.1-1038s1c1
Sequence:CCGGCATCAAGTGCAGCAAGGTGTTCTCGAGAACACCTTGCTGCACTTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_005263.1-1461s1c1
Sequence:CCGGCGACCTCTGTGGGAAGGGTTTCTCGAGAAACCCTTCCCACAGAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005263.1-617s1c1
Sequence:CCGGTGCCTTTCAAACCGTACTCATCTCGAGATGAGTACGGTTTGAAAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005263
VALIDATED
GFI1 MISSION shRNA shRNA Plasmid DNA
growth factor independent 1 transcription repressor
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005263.3-1175s21c1
Sequence:CCGGGAACGGAGCTTTGACTGTAAGCTCGAGCTTACAGTCAAAGCTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005263.1-2068s1c1
Sequence:CCGGGCCTATAAATCTTGGAGGAATCTCGAGATTCCTCCAAGATTTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_005263.1-334s1c1
Sequence:CCGGCCAGACTATTCCCTCCGTTTACTCGAGTAAACGGAGGGAATAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_005263.1-1038s1c1
Sequence:CCGGCATCAAGTGCAGCAAGGTGTTCTCGAGAACACCTTGCTGCACTTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_005263.1-1461s1c1
Sequence:CCGGCGACCTCTGTGGGAAGGGTTTCTCGAGAAACCCTTCCCACAGAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005263.1-617s1c1
Sequence:CCGGTGCCTTTCAAACCGTACTCATCTCGAGATGAGTACGGTTTGAAAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005263
VALIDATED
GFI1 MISSION shRNA Lentiviral Transduction Particles
growth factor independent 1 transcription repressor
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005263.3-1175s21c1
Sequence:CCGGGAACGGAGCTTTGACTGTAAGCTCGAGCTTACAGTCAAAGCTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005263.1-2068s1c1
Sequence:CCGGGCCTATAAATCTTGGAGGAATCTCGAGATTCCTCCAAGATTTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_005263.1-334s1c1
Sequence:CCGGCCAGACTATTCCCTCCGTTTACTCGAGTAAACGGAGGGAATAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_005263.1-1038s1c1
Sequence:CCGGCATCAAGTGCAGCAAGGTGTTCTCGAGAACACCTTGCTGCACTTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_005263.1-1461s1c1
Sequence:CCGGCGACCTCTGTGGGAAGGGTTTCTCGAGAAACCCTTCCCACAGAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005263.1-617s1c1
Sequence:CCGGTGCCTTTCAAACCGTACTCATCTCGAGATGAGTACGGTTTGAAAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010278
GFI1 MISSION shRNA Bacterial Glycerol Stock
growth factor independent 1 transcription repressor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010278.1-2402s1c1
Sequence:CCGGCGCAGTTATCAGAGTAAGGAACTCGAGTTCCTTACTCTGATAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010278.1-1264s1c1
Sequence:CCGGCGGCTCCTACAAATGCATCAACTCGAGTTGATGCATTTGTAGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010278.1-1653s1c1
Sequence:CCGGACCTCATCACTCATAGCAGAACTCGAGTTCTGCTATGAGTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010278.1-844s1c1
Sequence:CCGGCCAGCCCTACACGCTGCCTTTCTCGAGAAAGGCAGCGTGTAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010278.1-1654s1c1
Sequence:CCGGCCTCATCACTCATAGCAGAAACTCGAGTTTCTGCTATGAGTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010278
GFI1 MISSION shRNA shRNA Plasmid DNA
growth factor independent 1 transcription repressor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010278.1-2402s1c1
Sequence:CCGGCGCAGTTATCAGAGTAAGGAACTCGAGTTCCTTACTCTGATAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010278.1-1264s1c1
Sequence:CCGGCGGCTCCTACAAATGCATCAACTCGAGTTGATGCATTTGTAGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010278.1-1653s1c1
Sequence:CCGGACCTCATCACTCATAGCAGAACTCGAGTTCTGCTATGAGTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010278.1-844s1c1
Sequence:CCGGCCAGCCCTACACGCTGCCTTTCTCGAGAAAGGCAGCGTGTAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010278.1-1654s1c1
Sequence:CCGGCCTCATCACTCATAGCAGAAACTCGAGTTTCTGCTATGAGTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010278
GFI1 MISSION shRNA Lentiviral Transduction Particles
growth factor independent 1 transcription repressor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010278.1-2402s1c1
Sequence:CCGGCGCAGTTATCAGAGTAAGGAACTCGAGTTCCTTACTCTGATAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010278.1-1264s1c1
Sequence:CCGGCGGCTCCTACAAATGCATCAACTCGAGTTGATGCATTTGTAGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010278.1-1653s1c1
Sequence:CCGGACCTCATCACTCATAGCAGAACTCGAGTTCTGCTATGAGTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010278.1-844s1c1
Sequence:CCGGCCAGCCCTACACGCTGCCTTTCTCGAGAAAGGCAGCGTGTAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010278.1-1654s1c1
Sequence:CCGGCCTCATCACTCATAGCAGAAACTCGAGTTTCTGCTATGAGTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks