EMAIL THIS PAGE TO A FRIEND

GFI1B

growth factor independent 1B transcription repressor

48 Gene Product Result for
UniProtKB ID: Q5VTD9, O95270, Q5VTD8, Q6FHZ2, Q6T888
Gene ID:
Mouse(14582) growth factor independent 1B
Rat(311832) growth factor independent 1B transcription repressor
Zebrafish(100151531) growth factor independent 1B transcription repressor
cow(537773) growth factor independent 1B transcription repressor
domestic cat(101090152) growth factor independent 1B transcription repressor
dog(491281) growth factor independent 1B transcription repressor
chicken(395977) growth factor independent 1B transcription repressor
domestic guinea pig(100729268) growth factor independent 1B transcription repressor
naked mole-rat(101703021) growth factor independent 1B transcription repressor
Goat(100861242) growth factor independent 1B transcription repressor
sheep(101112798) growth factor independent 1B transcription repressor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004188 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008114 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008114 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008114 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU055591 MISSION® esiRNA esiRNA targeting mouse Gfi1b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004188 Rosetta Predictions human pricing
NM_001107823 Rosetta Predictions rat pricing
NM_008114 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223543 predicted 816
2 SASI_Hs01_00223544 predicted 311
3 SASI_Hs01_00223545 predicted 418
4 SASI_Hs02_00337076 predicted 451
5 SASI_Hs01_00223547 predicted 635
6 SASI_Hs01_00223548 predicted 282
7 SASI_Hs01_00223549 predicted 553
8 SASI_Hs01_00223550 predicted 944
9 SASI_Hs01_00223551 predicted 315
10 SASI_Hs01_00223552 predicted 468
11 SASI_Hs01_00223546 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107823 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232625 predicted 876
2 SASI_Rn02_00232626 predicted 1242
3 SASI_Rn02_00232627 predicted 1030
4 SASI_Rn02_00232628 predicted 1151
5 SASI_Rn02_00232629 predicted 600
6 SASI_Rn02_00232630 predicted 1283
7 SASI_Rn02_00232631 predicted 910
8 SASI_Rn02_00232632 predicted 1330
9 SASI_Rn02_00232633 predicted 408
10 SASI_Rn02_00232634 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159018 predicted 1436
2 SASI_Mm01_00159019 predicted 797
3 SASI_Mm01_00159020 predicted 1134
4 SASI_Mm01_00159021 predicted 1096
5 SASI_Mm01_00159022 predicted 1362
6 SASI_Mm01_00159023 predicted 1317
7 SASI_Mm01_00159024 predicted 559
8 SASI_Mm01_00159026 predicted 1419
9 SASI_Mm01_00159027 predicted 1302
10 SASI_Mm02_00313176 predicted 811
11 SASI_Mm01_00159025 predicted 906
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004188
GFI1B MISSION shRNA Bacterial Glycerol Stock
growth factor independent 1B transcription repressor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004188.2-448s1c1
Sequence:CCGGCCCATTCTACAAGCCTAGCTTCTCGAGAAGCTAGGCTTGTAGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004188.2-1120s1c1
Sequence:CCGGCGAGAGTCAACACAATCTCAACTCGAGTTGAGATTGTGTTGACTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004188.2-286s1c1
Sequence:CCGGCCTTAGCACTCTATTCCCAAACTCGAGTTTGGGAATAGAGTGCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004188.2-640s1c1
Sequence:CCGGCCACTGTGTGAAGTGCAACAACTCGAGTTGTTGCACTTCACACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004188.2-1546s1c1
Sequence:CCGGCCGGCCTCTTTCTGGCTATAACTCGAGTTATAGCCAGAAAGAGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004188.4-937s21c1
Sequence:CCGGCATGAAGAAGCACACCTACATCTCGAGATGTAGGTGTGCTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004188.4-1383s21c1
Sequence:CCGGGTTTCCAGGTGTGCTCAAGTGCTCGAGCACTTGAGCACACCTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004188.4-1309s21c1
Sequence:CCGGCTTACCCTGTCTGGATCAACACTCGAGTGTTGATCCAGACAGGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004188
GFI1B MISSION shRNA shRNA Plasmid DNA
growth factor independent 1B transcription repressor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004188.2-448s1c1
Sequence:CCGGCCCATTCTACAAGCCTAGCTTCTCGAGAAGCTAGGCTTGTAGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004188.2-1120s1c1
Sequence:CCGGCGAGAGTCAACACAATCTCAACTCGAGTTGAGATTGTGTTGACTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004188.2-286s1c1
Sequence:CCGGCCTTAGCACTCTATTCCCAAACTCGAGTTTGGGAATAGAGTGCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004188.2-640s1c1
Sequence:CCGGCCACTGTGTGAAGTGCAACAACTCGAGTTGTTGCACTTCACACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004188.2-1546s1c1
Sequence:CCGGCCGGCCTCTTTCTGGCTATAACTCGAGTTATAGCCAGAAAGAGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004188.4-937s21c1
Sequence:CCGGCATGAAGAAGCACACCTACATCTCGAGATGTAGGTGTGCTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004188.4-1383s21c1
Sequence:CCGGGTTTCCAGGTGTGCTCAAGTGCTCGAGCACTTGAGCACACCTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004188.4-1309s21c1
Sequence:CCGGCTTACCCTGTCTGGATCAACACTCGAGTGTTGATCCAGACAGGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004188
GFI1B MISSION shRNA Lentiviral Transduction Particles
growth factor independent 1B transcription repressor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004188.2-448s1c1
Sequence:CCGGCCCATTCTACAAGCCTAGCTTCTCGAGAAGCTAGGCTTGTAGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004188.2-1120s1c1
Sequence:CCGGCGAGAGTCAACACAATCTCAACTCGAGTTGAGATTGTGTTGACTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004188.2-286s1c1
Sequence:CCGGCCTTAGCACTCTATTCCCAAACTCGAGTTTGGGAATAGAGTGCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004188.2-640s1c1
Sequence:CCGGCCACTGTGTGAAGTGCAACAACTCGAGTTGTTGCACTTCACACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004188.2-1546s1c1
Sequence:CCGGCCGGCCTCTTTCTGGCTATAACTCGAGTTATAGCCAGAAAGAGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004188.4-937s21c1
Sequence:CCGGCATGAAGAAGCACACCTACATCTCGAGATGTAGGTGTGCTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004188.4-1383s21c1
Sequence:CCGGGTTTCCAGGTGTGCTCAAGTGCTCGAGCACTTGAGCACACCTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004188.4-1309s21c1
Sequence:CCGGCTTACCCTGTCTGGATCAACACTCGAGTGTTGATCCAGACAGGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008114
GFI1B MISSION shRNA Bacterial Glycerol Stock
growth factor independent 1B transcription repressor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008114.2-619s1c1
Sequence:CCGGCCACTGTGTCAAGTGCAACAACTCGAGTTGTTGCACTTGACACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008114.2-260s1c1
Sequence:CCGGCCTCTTCTCAGCACACCGCTTCTCGAGAAGCGGTGTGCTGAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008114.2-1093s1c1
Sequence:CCGGTCACCGTGAGAGTCAACACAACTCGAGTTGTGTTGACTCTCACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008114.2-216s1c1
Sequence:CCGGCTGCTGTAATTCCTGTGGCAACTCGAGTTGCCACAGGAATTACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008114.2-898s1c1
Sequence:CCGGCTTCCACCAGAAGTCGGACATCTCGAGATGTCCGACTTCTGGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008114
GFI1B MISSION shRNA shRNA Plasmid DNA
growth factor independent 1B transcription repressor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008114.2-619s1c1
Sequence:CCGGCCACTGTGTCAAGTGCAACAACTCGAGTTGTTGCACTTGACACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008114.2-260s1c1
Sequence:CCGGCCTCTTCTCAGCACACCGCTTCTCGAGAAGCGGTGTGCTGAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008114.2-1093s1c1
Sequence:CCGGTCACCGTGAGAGTCAACACAACTCGAGTTGTGTTGACTCTCACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008114.2-216s1c1
Sequence:CCGGCTGCTGTAATTCCTGTGGCAACTCGAGTTGCCACAGGAATTACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008114.2-898s1c1
Sequence:CCGGCTTCCACCAGAAGTCGGACATCTCGAGATGTCCGACTTCTGGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008114
GFI1B MISSION shRNA Lentiviral Transduction Particles
growth factor independent 1B transcription repressor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008114.2-619s1c1
Sequence:CCGGCCACTGTGTCAAGTGCAACAACTCGAGTTGTTGCACTTGACACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008114.2-260s1c1
Sequence:CCGGCCTCTTCTCAGCACACCGCTTCTCGAGAAGCGGTGTGCTGAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008114.2-1093s1c1
Sequence:CCGGTCACCGTGAGAGTCAACACAACTCGAGTTGTGTTGACTCTCACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008114.2-216s1c1
Sequence:CCGGCTGCTGTAATTCCTGTGGCAACTCGAGTTGCCACAGGAATTACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008114.2-898s1c1
Sequence:CCGGCTTCCACCAGAAGTCGGACATCTCGAGATGTCCGACTTCTGGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks