EMAIL THIS PAGE TO A FRIEND

GFM2

G elongation factor, mitochondrial 2

71 Gene Product Result for
Synonyms: EF-G2mt EFG2 MRRF2 MST027 RRF2 RRF2mt hEFG2 mEF-G 2
UniProtKB ID: Q969S9, A0AR28, Q8N6D8, Q8WYI0, Q9H6Z1
Gene ID:
Human(84340) Summary: Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of mitochondrial translation elongation factors. Its role in the regulation of normal mitochondrial function and in different disease states attributed to mitochondrial dysfunction is not known. Alternative splicing results in at least three transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(320806) G elongation factor, mitochondrial 2
Rat(294672) G elongation factor, mitochondrial 2
domestic guinea pig(100731888) G elongation factor, mitochondrial 2
naked mole-rat(101708331) G elongation factor, mitochondrial 2
sheep(101111659) G elongation factor, mitochondrial 2
Domestic Rabbit(100344691) G elongation factor, mitochondrial 2
Zebrafish(558184) G elongation factor, mitochondrial 2
cow(527467) G elongation factor, mitochondrial 2
Horse(100065622) G elongation factor, mitochondrial 2
domestic cat(101097698) G elongation factor, mitochondrial 2
chicken(427205) G elongation factor, mitochondrial 2
dog(478101) G elongation factor, mitochondrial 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032380 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032380 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032380 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177266 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177266 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177266 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032380 Rosetta Predictions human pricing
NM_170681 Rosetta Predictions human pricing
NM_170691 Rosetta Predictions human pricing
XM_226707 Rosetta Predictions rat pricing
NM_177266 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080555 predicted 574
2 SASI_Hs01_00080556 predicted 674
3 SASI_Hs02_00359774 predicted 911
4 SASI_Hs01_00080557 predicted 647
5 SASI_Hs01_00080558 predicted 337
6 SASI_Hs01_00080559 predicted 1118
7 SASI_Hs01_00080560 predicted 336
8 SASI_Hs01_00080563 predicted 555
9 SASI_Hs01_00080564 predicted 311
10 SASI_Hs02_00359775 predicted 711
11 SASI_Hs01_00080561 predicted 938
12 SASI_Hs01_00080562 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186518 predicted 567
2 SASI_Hs01_00186519 predicted 679
3 SASI_Hs02_00367604 predicted 909
4 SASI_Hs01_00186520 predicted 650
5 SASI_Hs01_00186521 predicted 338
6 SASI_Hs01_00186522 predicted 1117
7 SASI_Hs01_00186523 predicted 335
8 SASI_Hs01_00186526 predicted 556
9 SASI_Hs01_00186527 predicted 311
10 SASI_Hs02_00367605 predicted 710
11 SASI_Hs01_00186524 predicted 938
12 SASI_Hs01_00186525 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122288 predicted 576
2 SASI_Hs01_00122289 predicted 675
3 SASI_Hs02_00367621 predicted 910
4 SASI_Hs01_00122290 predicted 651
5 SASI_Hs01_00122291 predicted 338
6 SASI_Hs01_00122292 predicted 1121
7 SASI_Hs01_00122293 predicted 331
8 SASI_Hs02_00367622 predicted 554
9 SASI_Hs01_00122296 predicted 318
10 SASI_Hs01_00122297 predicted 705
11 SASI_Hs01_00122294 predicted 945
12 SASI_Hs01_00122295 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383805 predicted 582
2 SASI_Rn02_00383806 predicted 322
3 SASI_Rn02_00383807 predicted 1529
4 SASI_Rn02_00383808 predicted 1075
5 SASI_Rn02_00383809 predicted 1693
6 SASI_Rn02_00383810 predicted 272
7 SASI_Rn02_00383811 predicted 842
8 SASI_Rn02_00383812 predicted 822
9 SASI_Rn02_00383813 predicted 1275
10 SASI_Rn02_00383814 predicted 1173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177266 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036175 predicted 1388
2 SASI_Mm01_00036176 predicted 488
3 SASI_Mm01_00036177 predicted 682
4 SASI_Mm02_00347306 predicted 1202
5 SASI_Mm01_00036178 predicted 705
6 SASI_Mm01_00036179 predicted 915
7 SASI_Mm01_00036180 predicted 1187
8 SASI_Mm01_00036181 predicted 2341
9 SASI_Mm01_00036182 predicted 1448
10 SASI_Mm01_00036184 predicted 1632
11 SASI_Mm01_00036183 predicted 2102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032380
VALIDATED
GFM2 MISSION shRNA Bacterial Glycerol Stock
G elongation factor, mitochondrial 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032380.3-1576s1c1
Sequence:CCGGCCCTTCATTGACTGCTGGTAACTCGAGTTACCAGCAGTCAATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032380.3-1853s1c1
Sequence:CCGGCCCAGTTTGAAAGTGAGGCTACTCGAGTAGCCTCACTTTCAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032380.3-2039s1c1
Sequence:CCGGGATAGAACTTTAGGAGACAAACTCGAGTTTGTCTCCTAAAGTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032380.3-1154s1c1
Sequence:CCGGGTTGCAGATTTGGATGATGAACTCGAGTTCATCATCCAAATCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032380.3-2235s1c1
Sequence:CCGGCAATTCAGGATGTAGCAATTACTCGAGTAATTGCTACATCCTGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032380.3-652s1c1
Sequence:CCGGGCGAGAAAGAGGCATTACTATCTCGAGATAGTAATGCCTCTTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032380.3-1003s21c1
Sequence:CCGGAGGAGTGGTGGATGTAGTAATCTCGAGATTACTACATCCACCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032380.3-574s21c1
Sequence:CCGGATTGTACTATTCCGGATATACCTCGAGGTATATCCGGAATAGTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032380.3-1465s21c1
Sequence:GTACCGGCATTTACTCAGGCACTATAAACTCGAGTTTATAGTGCCTGAGTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032380.3-2673s21c1
Sequence:CCGGGAGCACCTAGCTACTTCATTTCTCGAGAAATGAAGTAGCTAGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032380.3-2502s21c1
Sequence:CCGGTAGCAGAAATTATGGGTTATTCTCGAGAATAACCCATAATTTCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032380
VALIDATED
GFM2 MISSION shRNA shRNA Plasmid DNA
G elongation factor, mitochondrial 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032380.3-1576s1c1
Sequence:CCGGCCCTTCATTGACTGCTGGTAACTCGAGTTACCAGCAGTCAATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032380.3-1853s1c1
Sequence:CCGGCCCAGTTTGAAAGTGAGGCTACTCGAGTAGCCTCACTTTCAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032380.3-2039s1c1
Sequence:CCGGGATAGAACTTTAGGAGACAAACTCGAGTTTGTCTCCTAAAGTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032380.3-1154s1c1
Sequence:CCGGGTTGCAGATTTGGATGATGAACTCGAGTTCATCATCCAAATCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032380.3-2235s1c1
Sequence:CCGGCAATTCAGGATGTAGCAATTACTCGAGTAATTGCTACATCCTGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032380.3-652s1c1
Sequence:CCGGGCGAGAAAGAGGCATTACTATCTCGAGATAGTAATGCCTCTTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032380.3-1003s21c1
Sequence:CCGGAGGAGTGGTGGATGTAGTAATCTCGAGATTACTACATCCACCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032380.3-574s21c1
Sequence:CCGGATTGTACTATTCCGGATATACCTCGAGGTATATCCGGAATAGTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032380.3-1465s21c1
Sequence:GTACCGGCATTTACTCAGGCACTATAAACTCGAGTTTATAGTGCCTGAGTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032380.3-2673s21c1
Sequence:CCGGGAGCACCTAGCTACTTCATTTCTCGAGAAATGAAGTAGCTAGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032380.3-2502s21c1
Sequence:CCGGTAGCAGAAATTATGGGTTATTCTCGAGAATAACCCATAATTTCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032380
VALIDATED
GFM2 MISSION shRNA Lentiviral Transduction Particles
G elongation factor, mitochondrial 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032380.3-1576s1c1
Sequence:CCGGCCCTTCATTGACTGCTGGTAACTCGAGTTACCAGCAGTCAATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032380.3-1853s1c1
Sequence:CCGGCCCAGTTTGAAAGTGAGGCTACTCGAGTAGCCTCACTTTCAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032380.3-2039s1c1
Sequence:CCGGGATAGAACTTTAGGAGACAAACTCGAGTTTGTCTCCTAAAGTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032380.3-1154s1c1
Sequence:CCGGGTTGCAGATTTGGATGATGAACTCGAGTTCATCATCCAAATCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032380.3-2235s1c1
Sequence:CCGGCAATTCAGGATGTAGCAATTACTCGAGTAATTGCTACATCCTGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032380.3-652s1c1
Sequence:CCGGGCGAGAAAGAGGCATTACTATCTCGAGATAGTAATGCCTCTTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032380.3-1003s21c1
Sequence:CCGGAGGAGTGGTGGATGTAGTAATCTCGAGATTACTACATCCACCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032380.3-574s21c1
Sequence:CCGGATTGTACTATTCCGGATATACCTCGAGGTATATCCGGAATAGTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032380.3-1465s21c1
Sequence:GTACCGGCATTTACTCAGGCACTATAAACTCGAGTTTATAGTGCCTGAGTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032380.3-2673s21c1
Sequence:CCGGGAGCACCTAGCTACTTCATTTCTCGAGAAATGAAGTAGCTAGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032380.3-2502s21c1
Sequence:CCGGTAGCAGAAATTATGGGTTATTCTCGAGAATAACCCATAATTTCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177266
VALIDATED
GFM2 MISSION shRNA Bacterial Glycerol Stock
G elongation factor, mitochondrial 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177266.3-728s1c1
Sequence:CCGGCCGGGAGAAGTTAAAGGCAAACTCGAGTTTGCCTTTAACTTCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177266.3-1632s1c1
Sequence:CCGGCGCGAAGATCCCAGTTTGAAACTCGAGTTTCAAACTGGGATCTTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177266.3-948s1c1
Sequence:CCGGGCAGACTTAGATGATGAGTTTCTCGAGAAACTCATCATCTAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177266.3-155s1c1
Sequence:CCGGGCACCTTAATACCATGTGTTACTCGAGTAACACATGGTATTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177266
VALIDATED
GFM2 MISSION shRNA shRNA Plasmid DNA
G elongation factor, mitochondrial 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177266.3-728s1c1
Sequence:CCGGCCGGGAGAAGTTAAAGGCAAACTCGAGTTTGCCTTTAACTTCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177266.3-1632s1c1
Sequence:CCGGCGCGAAGATCCCAGTTTGAAACTCGAGTTTCAAACTGGGATCTTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177266.3-948s1c1
Sequence:CCGGGCAGACTTAGATGATGAGTTTCTCGAGAAACTCATCATCTAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177266.3-155s1c1
Sequence:CCGGGCACCTTAATACCATGTGTTACTCGAGTAACACATGGTATTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177266
VALIDATED
GFM2 MISSION shRNA Lentiviral Transduction Particles
G elongation factor, mitochondrial 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177266.3-728s1c1
Sequence:CCGGCCGGGAGAAGTTAAAGGCAAACTCGAGTTTGCCTTTAACTTCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177266.3-1632s1c1
Sequence:CCGGCGCGAAGATCCCAGTTTGAAACTCGAGTTTCAAACTGGGATCTTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177266.3-948s1c1
Sequence:CCGGGCAGACTTAGATGATGAGTTTCTCGAGAAACTCATCATCTAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177266.3-155s1c1
Sequence:CCGGGCACCTTAATACCATGTGTTACTCGAGTAACACATGGTATTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks