EMAIL THIS PAGE TO A FRIEND

GFOD1

glucose-fructose oxidoreductase domain containing 1

57 Gene Product Result for
Synonyms: ADG-90 C6orf114
UniProtKB ID: Q9NXC2, A8E4L6, Q5T058, Q96JD4, Q9H5K2
Gene ID:
Mouse(328232) glucose-fructose oxidoreductase domain containing 1
Rat(306842) glucose-fructose oxidoreductase domain containing 1
chicken(770283) glucose-fructose oxidoreductase domain containing 1
dog(488222) glucose-fructose oxidoreductase domain containing 1
cow(520966) glucose-fructose oxidoreductase domain containing 1
domestic cat(101090436) glucose-fructose oxidoreductase domain containing 1
sheep(101104352) glucose-fructose oxidoreductase domain containing 1
Domestic Rabbit(100338061) glucose-fructose oxidoreductase domain containing 1
naked mole-rat(101723454) glucose-fructose oxidoreductase domain containing 1
domestic guinea pig(100717366) glucose-fructose oxidoreductase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018988 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018988 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018988 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018988 Rosetta Predictions human pricing
XM_001060607 Rosetta Predictions rat pricing
XM_225228 Rosetta Predictions rat pricing
NM_001033399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158655 predicted 1811
2 SASI_Hs01_00158656 predicted 891
3 SASI_Hs01_00158657 predicted 806
4 SASI_Hs01_00158658 predicted 1034
5 SASI_Hs01_00158659 predicted 1238
6 SASI_Hs02_00352483 predicted 1527
7 SASI_Hs01_00158660 predicted 1675
8 SASI_Hs01_00158661 predicted 1521
9 SASI_Hs01_00158662 predicted 2193
10 SASI_Hs02_00352484 predicted 1296
11 SASI_Hs01_00158654 predicted 2128
12 SASI_Hs01_00158663 predicted 2065
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297144 predicted 450
2 SASI_Rn02_00297145 predicted 1146
3 SASI_Rn02_00297146 predicted 647
4 SASI_Rn02_00297147 predicted 836
5 SASI_Rn02_00297148 predicted 1145
6 SASI_Rn02_00297149 predicted 781
7 SASI_Rn02_00297150 predicted 642
8 SASI_Rn02_00297151 predicted 336
9 SASI_Rn02_00297152 predicted 825
10 SASI_Rn02_00297153 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382657 predicted 1147
2 SASI_Rn02_00382658 predicted 853
3 SASI_Rn02_00382659 predicted 648
4 SASI_Rn02_00382660 predicted 835
5 SASI_Rn02_00382661 predicted 1145
6 SASI_Rn02_00382662 predicted 783
7 SASI_Rn02_00382663 predicted 649
8 SASI_Rn02_00382664 predicted 825
9 SASI_Rn02_00382665 predicted 1016
10 SASI_Rn02_00382666 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193770 predicted 1123
2 SASI_Mm01_00193771 predicted 1514
3 SASI_Mm01_00193772 predicted 1880
4 SASI_Mm01_00193773 predicted 929
5 SASI_Mm01_00193775 predicted 1247
6 SASI_Mm01_00193776 predicted 1718
7 SASI_Mm01_00193777 predicted 1988
8 SASI_Mm01_00193778 predicted 1545
9 SASI_Mm01_00193779 predicted 2048
10 SASI_Mm02_00288696 predicted 1955
11 SASI_Mm01_00193774 predicted 930
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033399
VALIDATED
GFOD1 MISSION shRNA Bacterial Glycerol Stock
glucose-fructose oxidoreductase domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033399.4-1133s21c1
Sequence:CCGGGTAGTCTGCTGGGCAAGAAATCTCGAGATTTCTTGCCCAGCAGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033399.4-1376s21c1
Sequence:CCGGCCGTTACCCTGAACTTCAATGCTCGAGCATTGAAGTTCAGGGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033399.4-1061s21c1
Sequence:CCGGTACGCATGAAGCAGCTGATTGCTCGAGCAATCAGCTGCTTCATGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033399.4-6392s21c1
Sequence:CCGGTGTCATTGTCTAGTCTATATTCTCGAGAATATAGACTAGACAATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033399.4-1466s21c1
Sequence:CCGGACCTCTATGGACAGCGCAATACTCGAGTATTGCGCTGTCCATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033399
VALIDATED
GFOD1 MISSION shRNA shRNA Plasmid DNA
glucose-fructose oxidoreductase domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033399.4-1133s21c1
Sequence:CCGGGTAGTCTGCTGGGCAAGAAATCTCGAGATTTCTTGCCCAGCAGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033399.4-1376s21c1
Sequence:CCGGCCGTTACCCTGAACTTCAATGCTCGAGCATTGAAGTTCAGGGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033399.4-1061s21c1
Sequence:CCGGTACGCATGAAGCAGCTGATTGCTCGAGCAATCAGCTGCTTCATGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033399.4-6392s21c1
Sequence:CCGGTGTCATTGTCTAGTCTATATTCTCGAGAATATAGACTAGACAATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033399.4-1466s21c1
Sequence:CCGGACCTCTATGGACAGCGCAATACTCGAGTATTGCGCTGTCCATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033399
VALIDATED
GFOD1 MISSION shRNA Lentiviral Transduction Particles
glucose-fructose oxidoreductase domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033399.4-1133s21c1
Sequence:CCGGGTAGTCTGCTGGGCAAGAAATCTCGAGATTTCTTGCCCAGCAGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033399.4-1376s21c1
Sequence:CCGGCCGTTACCCTGAACTTCAATGCTCGAGCATTGAAGTTCAGGGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033399.4-1061s21c1
Sequence:CCGGTACGCATGAAGCAGCTGATTGCTCGAGCAATCAGCTGCTTCATGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033399.4-6392s21c1
Sequence:CCGGTGTCATTGTCTAGTCTATATTCTCGAGAATATAGACTAGACAATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033399.4-1466s21c1
Sequence:CCGGACCTCTATGGACAGCGCAATACTCGAGTATTGCGCTGTCCATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018988
VALIDATED
GFOD1 MISSION shRNA Bacterial Glycerol Stock
glucose-fructose oxidoreductase domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018988.2-712s21c1
Sequence:CCGGTCATCATCCCGCTGCTGAAAGCTCGAGCTTTCAGCAGCGGGATGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018988.2-855s21c1
Sequence:CCGGGTGGACTTGGTGTGCATTAACCTCGAGGTTAATGCACACCAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018988.2-811s21c1
Sequence:CCGGCCTTCTACACTAGCCGCATTGCTCGAGCAATGCGGCTAGTGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018988.2-2637s21c1
Sequence:CCGGCTGCAAGGAGTCACCTTATAACTCGAGTTATAAGGTGACTCCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018988.2-1365s21c1
Sequence:CCGGACCGTCACCCTCAACTTCAACCTCGAGGTTGAAGTTGAGGGTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018988.1-2609s1c1
Sequence:CCGGCCCTTTGAACTTGTCAACAATCTCGAGATTGTTGACAAGTTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018988.1-891s1c1
Sequence:CCGGACCAGACAGATCGCTGTCAAACTCGAGTTTGACAGCGATCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018988.1-1739s1c1
Sequence:CCGGGTGGCAGAACATTGCCATCATCTCGAGATGATGGCAATGTTCTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018988.1-1304s1c1
Sequence:CCGGACAGATCACCAGCGATGACTTCTCGAGAAGTCATCGCTGGTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_018988.1-854s1c1
Sequence:CCGGCGTGGACTTGGTGTGCATTAACTCGAGTTAATGCACACCAAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018988
VALIDATED
GFOD1 MISSION shRNA shRNA Plasmid DNA
glucose-fructose oxidoreductase domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018988.2-712s21c1
Sequence:CCGGTCATCATCCCGCTGCTGAAAGCTCGAGCTTTCAGCAGCGGGATGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018988.2-855s21c1
Sequence:CCGGGTGGACTTGGTGTGCATTAACCTCGAGGTTAATGCACACCAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018988.2-811s21c1
Sequence:CCGGCCTTCTACACTAGCCGCATTGCTCGAGCAATGCGGCTAGTGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018988.2-2637s21c1
Sequence:CCGGCTGCAAGGAGTCACCTTATAACTCGAGTTATAAGGTGACTCCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018988.2-1365s21c1
Sequence:CCGGACCGTCACCCTCAACTTCAACCTCGAGGTTGAAGTTGAGGGTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018988.1-2609s1c1
Sequence:CCGGCCCTTTGAACTTGTCAACAATCTCGAGATTGTTGACAAGTTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018988.1-891s1c1
Sequence:CCGGACCAGACAGATCGCTGTCAAACTCGAGTTTGACAGCGATCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018988.1-1739s1c1
Sequence:CCGGGTGGCAGAACATTGCCATCATCTCGAGATGATGGCAATGTTCTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018988.1-1304s1c1
Sequence:CCGGACAGATCACCAGCGATGACTTCTCGAGAAGTCATCGCTGGTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_018988.1-854s1c1
Sequence:CCGGCGTGGACTTGGTGTGCATTAACTCGAGTTAATGCACACCAAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018988
VALIDATED
GFOD1 MISSION shRNA Lentiviral Transduction Particles
glucose-fructose oxidoreductase domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018988.2-712s21c1
Sequence:CCGGTCATCATCCCGCTGCTGAAAGCTCGAGCTTTCAGCAGCGGGATGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018988.2-855s21c1
Sequence:CCGGGTGGACTTGGTGTGCATTAACCTCGAGGTTAATGCACACCAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018988.2-811s21c1
Sequence:CCGGCCTTCTACACTAGCCGCATTGCTCGAGCAATGCGGCTAGTGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018988.2-2637s21c1
Sequence:CCGGCTGCAAGGAGTCACCTTATAACTCGAGTTATAAGGTGACTCCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018988.2-1365s21c1
Sequence:CCGGACCGTCACCCTCAACTTCAACCTCGAGGTTGAAGTTGAGGGTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018988.1-2609s1c1
Sequence:CCGGCCCTTTGAACTTGTCAACAATCTCGAGATTGTTGACAAGTTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018988.1-891s1c1
Sequence:CCGGACCAGACAGATCGCTGTCAAACTCGAGTTTGACAGCGATCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018988.1-1739s1c1
Sequence:CCGGGTGGCAGAACATTGCCATCATCTCGAGATGATGGCAATGTTCTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018988.1-1304s1c1
Sequence:CCGGACAGATCACCAGCGATGACTTCTCGAGAAGTCATCGCTGGTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_018988.1-854s1c1
Sequence:CCGGCGTGGACTTGGTGTGCATTAACTCGAGTTAATGCACACCAAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks