EMAIL THIS PAGE TO A FRIEND

GFOD2

glucose-fructose oxidoreductase domain containing 2

72 Gene Product Result for
UniProtKB ID: Q3B7J2, Q69YL9, Q6UXX6, Q7L648, Q8TE86, Q9BQ07
Gene ID:
Mouse(70575) glucose-fructose oxidoreductase domain containing 2
Rat(307801) glucose-fructose oxidoreductase domain containing 2
Zebrafish(777639) glucose-fructose oxidoreductase domain containing 2
cow(507361) glucose-fructose oxidoreductase domain containing 2
Horse(100147209) glucose-fructose oxidoreductase domain containing 2
domestic cat(101080419) glucose-fructose oxidoreductase domain containing 2
dog(489755) glucose-fructose oxidoreductase domain containing 2
chicken(415642) glucose-fructose oxidoreductase domain containing 2
domestic guinea pig(100731751) glucose-fructose oxidoreductase domain containing 2
naked mole-rat(101706822) glucose-fructose oxidoreductase domain containing 2
sheep(101115644) glucose-fructose oxidoreductase domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030819 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030819 Rosetta Predictions human pricing
NM_001107421 Rosetta Predictions rat pricing
NM_027469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027486 predicted 1366
2 SASI_Hs02_00358404 predicted 626
3 SASI_Hs01_00027487 predicted 486
4 SASI_Hs01_00027488 predicted 894
5 SASI_Hs02_00358405 predicted 1352
6 SASI_Hs01_00027489 predicted 948
7 SASI_Hs01_00027490 predicted 588
8 SASI_Hs01_00027491 predicted 575
9 SASI_Hs01_00027492 predicted 557
10 SASI_Hs01_00027494 predicted 1263
11 SASI_Hs01_00027493 predicted 982
12 SASI_Hs01_00027495 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228655 predicted 1238
2 SASI_Rn02_00228656 predicted 651
3 SASI_Rn02_00228657 predicted 1366
4 SASI_Rn02_00228658 predicted 1257
5 SASI_Rn02_00228659 predicted 1262
6 SASI_Rn02_00228660 predicted 806
7 SASI_Rn02_00228661 predicted 826
8 SASI_Rn02_00228662 predicted 513
9 SASI_Rn02_00228663 predicted 1373
10 SASI_Rn02_00228664 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022024 predicted 1346
2 SASI_Mm01_00022025 predicted 1256
3 SASI_Mm02_00332268 predicted 1343
4 SASI_Mm01_00022026 predicted 964
5 SASI_Mm01_00022027 predicted 1464
6 SASI_Mm01_00022028 predicted 413
7 SASI_Mm01_00022029 predicted 475
8 SASI_Mm01_00022030 predicted 811
9 SASI_Mm01_00022031 predicted 1507
10 SASI_Mm01_00022032 predicted 1242
11 SASI_Mm01_00022033 predicted 1678
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027469
VALIDATED
GFOD2 MISSION shRNA Bacterial Glycerol Stock
glucose-fructose oxidoreductase domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027469.1-1682s1c1
Sequence:CCGGGCAGGGCCAATGAAGATCAATCTCGAGATTGATCTTCATTGGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027469.1-1149s1c1
Sequence:CCGGCTTGAAAGGTATGGTCTATATCTCGAGATATAGACCATACCTTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027469.1-1348s1c1
Sequence:CCGGCCAGATGCCAACCAGAATCTACTCGAGTAGATTCTGGTTGGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027469.1-1275s1c1
Sequence:CCGGGAGCGTGGTAGATGCTATTAACTCGAGTTAATAGCATCTACCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027469.1-1355s1c1
Sequence:CCGGCCAACCAGAATCTAAGTGAAACTCGAGTTTCACTTAGATTCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027469.4-1274s21c1
Sequence:CCGGGAGCGTGGTAGATGCTATTAACTCGAGTTAATAGCATCTACCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027469.4-1148s21c1
Sequence:CCGGCTTGAAAGGTATGGTCTATATCTCGAGATATAGACCATACCTTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027469.4-1250s21c1
Sequence:CCGGATTCGAGGACGGACTGTATATCTCGAGATATACAGTCCGTCCTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027469.4-1773s21c1
Sequence:CCGGTTAGGGTAGATGGCAAGAAACCTCGAGGTTTCTTGCCATCTACCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027469
VALIDATED
GFOD2 MISSION shRNA shRNA Plasmid DNA
glucose-fructose oxidoreductase domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027469.1-1682s1c1
Sequence:CCGGGCAGGGCCAATGAAGATCAATCTCGAGATTGATCTTCATTGGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027469.1-1149s1c1
Sequence:CCGGCTTGAAAGGTATGGTCTATATCTCGAGATATAGACCATACCTTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027469.1-1348s1c1
Sequence:CCGGCCAGATGCCAACCAGAATCTACTCGAGTAGATTCTGGTTGGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027469.1-1275s1c1
Sequence:CCGGGAGCGTGGTAGATGCTATTAACTCGAGTTAATAGCATCTACCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027469.1-1355s1c1
Sequence:CCGGCCAACCAGAATCTAAGTGAAACTCGAGTTTCACTTAGATTCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027469.4-1274s21c1
Sequence:CCGGGAGCGTGGTAGATGCTATTAACTCGAGTTAATAGCATCTACCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027469.4-1148s21c1
Sequence:CCGGCTTGAAAGGTATGGTCTATATCTCGAGATATAGACCATACCTTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027469.4-1250s21c1
Sequence:CCGGATTCGAGGACGGACTGTATATCTCGAGATATACAGTCCGTCCTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027469.4-1773s21c1
Sequence:CCGGTTAGGGTAGATGGCAAGAAACCTCGAGGTTTCTTGCCATCTACCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027469
VALIDATED
GFOD2 MISSION shRNA Lentiviral Transduction Particles
glucose-fructose oxidoreductase domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027469.1-1682s1c1
Sequence:CCGGGCAGGGCCAATGAAGATCAATCTCGAGATTGATCTTCATTGGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027469.1-1149s1c1
Sequence:CCGGCTTGAAAGGTATGGTCTATATCTCGAGATATAGACCATACCTTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027469.1-1348s1c1
Sequence:CCGGCCAGATGCCAACCAGAATCTACTCGAGTAGATTCTGGTTGGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027469.1-1275s1c1
Sequence:CCGGGAGCGTGGTAGATGCTATTAACTCGAGTTAATAGCATCTACCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027469.1-1355s1c1
Sequence:CCGGCCAACCAGAATCTAAGTGAAACTCGAGTTTCACTTAGATTCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027469.4-1274s21c1
Sequence:CCGGGAGCGTGGTAGATGCTATTAACTCGAGTTAATAGCATCTACCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027469.4-1148s21c1
Sequence:CCGGCTTGAAAGGTATGGTCTATATCTCGAGATATAGACCATACCTTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027469.4-1250s21c1
Sequence:CCGGATTCGAGGACGGACTGTATATCTCGAGATATACAGTCCGTCCTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027469.4-1773s21c1
Sequence:CCGGTTAGGGTAGATGGCAAGAAACCTCGAGGTTTCTTGCCATCTACCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030819
VALIDATED
GFOD2 MISSION shRNA Bacterial Glycerol Stock
glucose-fructose oxidoreductase domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030819.2-956s1c1
Sequence:CCGGAGTGACACTCAACTTCAACATCTCGAGATGTTGAAGTTGAGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_030819.2-423s1c1
Sequence:CCGGGACATCTTGCTGCATCAAGATCTCGAGATCTTGATGCAGCAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_030819.2-893s1c1
Sequence:CCGGGCACGTCACTAGCGATGACTTCTCGAGAAGTCATCGCTAGTGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_030819.2-630s1c1
Sequence:CCGGCCTGCCTTCGTGCGCATGAAACTCGAGTTTCATGCGCACGAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030819.2-497s1c1
Sequence:CCGGGAAGGCTCTAGGTATTGGGAACTCGAGTTCCCAATACCTAGAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030819.3-1865s21c1
Sequence:CCGGAGGAACAGTGAGGGCAACAAGCTCGAGCTTGTTGCCCTCACTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030819.3-714s21c1
Sequence:CCGGACTATGTGGGAGCGGTGATGACTCGAGTCATCACCGCTCCCACATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030819.3-1626s21c1
Sequence:CCGGACTTGCAGGGTGGCAAATGTTCTCGAGAACATTTGCCACCCTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030819.3-776s21c1
Sequence:CCGGAGCTATGGCTGGATCTGTGATCTCGAGATCACAGATCCAGCCATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030819
VALIDATED
GFOD2 MISSION shRNA shRNA Plasmid DNA
glucose-fructose oxidoreductase domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030819.2-956s1c1
Sequence:CCGGAGTGACACTCAACTTCAACATCTCGAGATGTTGAAGTTGAGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_030819.2-423s1c1
Sequence:CCGGGACATCTTGCTGCATCAAGATCTCGAGATCTTGATGCAGCAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_030819.2-893s1c1
Sequence:CCGGGCACGTCACTAGCGATGACTTCTCGAGAAGTCATCGCTAGTGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_030819.2-630s1c1
Sequence:CCGGCCTGCCTTCGTGCGCATGAAACTCGAGTTTCATGCGCACGAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030819.2-497s1c1
Sequence:CCGGGAAGGCTCTAGGTATTGGGAACTCGAGTTCCCAATACCTAGAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030819.3-1865s21c1
Sequence:CCGGAGGAACAGTGAGGGCAACAAGCTCGAGCTTGTTGCCCTCACTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030819.3-714s21c1
Sequence:CCGGACTATGTGGGAGCGGTGATGACTCGAGTCATCACCGCTCCCACATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030819.3-1626s21c1
Sequence:CCGGACTTGCAGGGTGGCAAATGTTCTCGAGAACATTTGCCACCCTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030819.3-776s21c1
Sequence:CCGGAGCTATGGCTGGATCTGTGATCTCGAGATCACAGATCCAGCCATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030819
VALIDATED
GFOD2 MISSION shRNA Lentiviral Transduction Particles
glucose-fructose oxidoreductase domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030819.2-956s1c1
Sequence:CCGGAGTGACACTCAACTTCAACATCTCGAGATGTTGAAGTTGAGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_030819.2-423s1c1
Sequence:CCGGGACATCTTGCTGCATCAAGATCTCGAGATCTTGATGCAGCAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_030819.2-893s1c1
Sequence:CCGGGCACGTCACTAGCGATGACTTCTCGAGAAGTCATCGCTAGTGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_030819.2-630s1c1
Sequence:CCGGCCTGCCTTCGTGCGCATGAAACTCGAGTTTCATGCGCACGAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030819.2-497s1c1
Sequence:CCGGGAAGGCTCTAGGTATTGGGAACTCGAGTTCCCAATACCTAGAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030819.3-1865s21c1
Sequence:CCGGAGGAACAGTGAGGGCAACAAGCTCGAGCTTGTTGCCCTCACTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030819.3-714s21c1
Sequence:CCGGACTATGTGGGAGCGGTGATGACTCGAGTCATCACCGCTCCCACATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030819.3-1626s21c1
Sequence:CCGGACTTGCAGGGTGGCAAATGTTCTCGAGAACATTTGCCACCCTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030819.3-776s21c1
Sequence:CCGGAGCTATGGCTGGATCTGTGATCTCGAGATCACAGATCCAGCCATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks