EMAIL THIS PAGE TO A FRIEND

GFPT1

glutamine--fructose-6-phosphate transaminase 1

Synonyms: CMSTA1 GFA GFAT GFAT 1 GFAT1 GFAT1m GFPT GFPT1L MSLG
UniProtKB ID: Q06210, Q53QE6, Q9BXF8
Gene ID:
Human(2673) Summary: This gene encodes the first and rate-limiting enzyme of the hexosamine pathway and controls the flux of glucose into the hexosamine pathway. The product of this gene catalyzes the formation of glucosamine 6-phosphate. [provided by RefSeq, Sep 2008]
Mouse(14583) glutamine fructose-6-phosphate transaminase 1
Rat(297417) glutamine fructose-6-phosphate transaminase 1
sheep(101116643) glutamine--fructose-6-phosphate transaminase 1
naked mole-rat(101700913) glutamine--fructose-6-phosphate transaminase 1
domestic guinea pig(100728229) glutamine--fructose-6-phosphate transaminase 1
Zebrafish(567861) glutamine-fructose-6-phosphate transaminase 1
cow(281779) glutamine--fructose-6-phosphate transaminase 1
Horse(100061157) glutamine--fructose-6-phosphate transaminase 1
domestic cat(101093346) glutamine--fructose-6-phosphate transaminase 1
dog(474624) glutamine--fructose-6-phosphate transaminase 1
chicken(419514) glutamine--fructose-6-phosphate transaminase 1
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301020 ANTI-GFPT1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
HPA047240 Anti-GFPT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2900743 Anti-GFPT1 antibody produced in rabbit affinity isolated antibody pig, mouse, human, rat, dog, chicken, guinea pig, monkey, bovine, horse
western blot pricing
SAB2900744 Anti-GFPT1 antibody produced in rabbit affinity isolated antibody rat, pig, monkey, human, bovine, mouse, guinea pig, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002056 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013528 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013528 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013528 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002056 Rosetta Predictions human pricing
NM_001005879 Rosetta Predictions rat pricing
NM_013528 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162618 predicted 1987
2 SASI_Hs01_00162619 predicted 1393
3 SASI_Hs02_00333099 predicted 1211
4 SASI_Hs02_00333100 predicted 774
5 SASI_Hs01_00162620 predicted 567
6 SASI_Hs02_00333101 predicted 1175
7 SASI_Hs01_00162621 predicted 2184
8 SASI_Hs01_00162622 predicted 334
9 SASI_Hs01_00162624 predicted 655
10 SASI_Hs02_00333102 predicted 1149
11 SASI_Hs01_00162617 predicted 1470
12 SASI_Hs01_00162623 predicted 2134
13 SASI_Hs01_00162625 predicted 1589
14 SASI_Hs01_00162626 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005879 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045359 predicted 1208
2 SASI_Rn01_00045360 predicted 1141
3 SASI_Rn01_00045361 predicted 397
4 SASI_Rn01_00045362 predicted 327
5 SASI_Rn01_00045363 predicted 1158
6 SASI_Rn01_00045364 predicted 1033
7 SASI_Rn01_00045365 predicted 469
8 SASI_Rn01_00045366 predicted 464
9 SASI_Rn01_00045367 predicted 1604
10 SASI_Rn01_00045368 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013528 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170346 predicted 230
2 SASI_Mm01_00170347 predicted 2154
3 SASI_Mm01_00170348 predicted 368
4 SASI_Mm01_00170349 predicted 1822
5 SASI_Mm01_00170351 predicted 1436
6 SASI_Mm02_00322223 predicted 520
7 SASI_Mm01_00170352 predicted 518
8 SASI_Mm01_00170353 predicted 1653
9 SASI_Mm01_00170354 predicted 943
10 SASI_Mm01_00170355 predicted 1635
11 SASI_Mm01_00170350 predicted 1381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002056
VALIDATED
GFPT1 MISSION shRNA Bacterial Glycerol Stock
glutamine--fructose-6-phosphate transaminase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002056.2-1041s21c1
Sequence:CCGGCGTCTTTCTATCCATCGAATTCTCGAGAATTCGATGGATAGAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002056.2-1458s21c1
Sequence:CCGGGCAGATACTTTGATGGGTCTTCTCGAGAAGACCCATCAAAGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002056.2-2928s21c1
Sequence:CCGGGCTGCTTTGGACAACTGACAACTCGAGTTGTCAGTTGTCCAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002056.2-1914s21c1
Sequence:CCGGCCTCTGGCTTTGGTGGATAAACTCGAGTTTATCCACCAAAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002056.1-1401s1c1
Sequence:CCGGGCAGATACTTTGATGGGTCTTCTCGAGAAGACCCATCAAAGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002056.1-1857s1c1
Sequence:CCGGCCTCTGGCTTTGGTGGATAAACTCGAGTTTATCCACCAAAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002056.1-2871s1c1
Sequence:CCGGGCTGCTTTGGACAACTGACAACTCGAGTTGTCAGTTGTCCAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002056.1-984s1c1
Sequence:CCGGCGTCTTTCTATCCATCGAATTCTCGAGAATTCGATGGATAGAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002056.1-1562s1c1
Sequence:CCGGCCAGTTTGTATCCCTTGTGATCTCGAGATCACAAGGGATACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002056
VALIDATED
GFPT1 MISSION shRNA shRNA Plasmid DNA
glutamine--fructose-6-phosphate transaminase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002056.2-1041s21c1
Sequence:CCGGCGTCTTTCTATCCATCGAATTCTCGAGAATTCGATGGATAGAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002056.2-1458s21c1
Sequence:CCGGGCAGATACTTTGATGGGTCTTCTCGAGAAGACCCATCAAAGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002056.2-2928s21c1
Sequence:CCGGGCTGCTTTGGACAACTGACAACTCGAGTTGTCAGTTGTCCAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002056.2-1914s21c1
Sequence:CCGGCCTCTGGCTTTGGTGGATAAACTCGAGTTTATCCACCAAAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002056.1-1401s1c1
Sequence:CCGGGCAGATACTTTGATGGGTCTTCTCGAGAAGACCCATCAAAGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002056.1-1857s1c1
Sequence:CCGGCCTCTGGCTTTGGTGGATAAACTCGAGTTTATCCACCAAAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002056.1-2871s1c1
Sequence:CCGGGCTGCTTTGGACAACTGACAACTCGAGTTGTCAGTTGTCCAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002056.1-984s1c1
Sequence:CCGGCGTCTTTCTATCCATCGAATTCTCGAGAATTCGATGGATAGAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002056.1-1562s1c1
Sequence:CCGGCCAGTTTGTATCCCTTGTGATCTCGAGATCACAAGGGATACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002056
VALIDATED
GFPT1 MISSION shRNA Lentiviral Transduction Particles
glutamine--fructose-6-phosphate transaminase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002056.2-1041s21c1
Sequence:CCGGCGTCTTTCTATCCATCGAATTCTCGAGAATTCGATGGATAGAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002056.2-1458s21c1
Sequence:CCGGGCAGATACTTTGATGGGTCTTCTCGAGAAGACCCATCAAAGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002056.2-2928s21c1
Sequence:CCGGGCTGCTTTGGACAACTGACAACTCGAGTTGTCAGTTGTCCAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002056.2-1914s21c1
Sequence:CCGGCCTCTGGCTTTGGTGGATAAACTCGAGTTTATCCACCAAAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002056.1-1401s1c1
Sequence:CCGGGCAGATACTTTGATGGGTCTTCTCGAGAAGACCCATCAAAGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002056.1-1857s1c1
Sequence:CCGGCCTCTGGCTTTGGTGGATAAACTCGAGTTTATCCACCAAAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002056.1-2871s1c1
Sequence:CCGGGCTGCTTTGGACAACTGACAACTCGAGTTGTCAGTTGTCCAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002056.1-984s1c1
Sequence:CCGGCGTCTTTCTATCCATCGAATTCTCGAGAATTCGATGGATAGAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002056.1-1562s1c1
Sequence:CCGGCCAGTTTGTATCCCTTGTGATCTCGAGATCACAAGGGATACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013528
VALIDATED
GFPT1 MISSION shRNA Bacterial Glycerol Stock
glutamine--fructose-6-phosphate transaminase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013528.3-2206s21c1
Sequence:CCGGCCTGAAACTTAAGACAGTTAACTCGAGTTAACTGTCTTAAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013528.3-2086s21c1
Sequence:CCGGCAGGGCATTCTCAGTGTGATTCTCGAGAATCACACTGAGAATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013528.3-1605s21c1
Sequence:CCGGCCTCGTGATGTTTGCTCTCATCTCGAGATGAGAGCAAACATCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013528.3-189s21c1
Sequence:CCGGTCCTCGAACAAGACGAGAAATCTCGAGATTTCTCGTCTTGTTCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013528.3-1097s21c1
Sequence:CCGGAGATCATGAAGGGCAACTTTACTCGAGTAAAGTTGCCCTTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013528.2-2202s1c1
Sequence:CCGGCCTGAAACTTAAGACAGTTAACTCGAGTTAACTGTCTTAAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013528.2-1601s1c1
Sequence:CCGGCCTCGTGATGTTTGCTCTCATCTCGAGATGAGAGCAAACATCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013528.2-323s1c1
Sequence:CCGGGCTCATTAAGAAGAAAGGAAACTCGAGTTTCCTTTCTTCTTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013528.2-2082s1c1
Sequence:CCGGCAGGGCATTCTCAGTGTGATTCTCGAGAATCACACTGAGAATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013528.2-1011s1c1
Sequence:CCGGCGTCTCTCTATCCACCGAATTCTCGAGAATTCGGTGGATAGAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013528
VALIDATED
GFPT1 MISSION shRNA shRNA Plasmid DNA
glutamine--fructose-6-phosphate transaminase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013528.3-2206s21c1
Sequence:CCGGCCTGAAACTTAAGACAGTTAACTCGAGTTAACTGTCTTAAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013528.3-2086s21c1
Sequence:CCGGCAGGGCATTCTCAGTGTGATTCTCGAGAATCACACTGAGAATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013528.3-1605s21c1
Sequence:CCGGCCTCGTGATGTTTGCTCTCATCTCGAGATGAGAGCAAACATCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013528.3-189s21c1
Sequence:CCGGTCCTCGAACAAGACGAGAAATCTCGAGATTTCTCGTCTTGTTCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013528.3-1097s21c1
Sequence:CCGGAGATCATGAAGGGCAACTTTACTCGAGTAAAGTTGCCCTTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013528.2-2202s1c1
Sequence:CCGGCCTGAAACTTAAGACAGTTAACTCGAGTTAACTGTCTTAAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013528.2-1601s1c1
Sequence:CCGGCCTCGTGATGTTTGCTCTCATCTCGAGATGAGAGCAAACATCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013528.2-323s1c1
Sequence:CCGGGCTCATTAAGAAGAAAGGAAACTCGAGTTTCCTTTCTTCTTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013528.2-2082s1c1
Sequence:CCGGCAGGGCATTCTCAGTGTGATTCTCGAGAATCACACTGAGAATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013528.2-1011s1c1
Sequence:CCGGCGTCTCTCTATCCACCGAATTCTCGAGAATTCGGTGGATAGAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013528
VALIDATED
GFPT1 MISSION shRNA Lentiviral Transduction Particles
glutamine--fructose-6-phosphate transaminase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013528.3-2206s21c1
Sequence:CCGGCCTGAAACTTAAGACAGTTAACTCGAGTTAACTGTCTTAAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013528.3-2086s21c1
Sequence:CCGGCAGGGCATTCTCAGTGTGATTCTCGAGAATCACACTGAGAATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013528.3-1605s21c1
Sequence:CCGGCCTCGTGATGTTTGCTCTCATCTCGAGATGAGAGCAAACATCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013528.3-189s21c1
Sequence:CCGGTCCTCGAACAAGACGAGAAATCTCGAGATTTCTCGTCTTGTTCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013528.3-1097s21c1
Sequence:CCGGAGATCATGAAGGGCAACTTTACTCGAGTAAAGTTGCCCTTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013528.2-2202s1c1
Sequence:CCGGCCTGAAACTTAAGACAGTTAACTCGAGTTAACTGTCTTAAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013528.2-1601s1c1
Sequence:CCGGCCTCGTGATGTTTGCTCTCATCTCGAGATGAGAGCAAACATCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013528.2-323s1c1
Sequence:CCGGGCTCATTAAGAAGAAAGGAAACTCGAGTTTCCTTTCTTCTTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013528.2-2082s1c1
Sequence:CCGGCAGGGCATTCTCAGTGTGATTCTCGAGAATCACACTGAGAATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013528.2-1011s1c1
Sequence:CCGGCGTCTCTCTATCCACCGAATTCTCGAGAATTCGGTGGATAGAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks