EMAIL THIS PAGE TO A FRIEND

GFPT2

glutamine-fructose-6-phosphate transaminase 2

140 Gene Product Result for
Synonyms: GFAT2
UniProtKB ID: O94808, Q53XM2, Q9BWS4
Gene ID:
Mouse(14584) glutamine fructose-6-phosphate transaminase 2
Rat(360518) glutamine-fructose-6-phosphate transaminase 2
Zebrafish(569945) glutamine-fructose-6-phosphate transaminase 2
chicken(426962) glutamine-fructose-6-phosphate transaminase 2
cow(530101) glutamine-fructose-6-phosphate transaminase 2
domestic cat(101084509) glutamine-fructose-6-phosphate transaminase 2
dog(474653) glutamine-fructose-6-phosphate transaminase 2
domestic guinea pig(100714983) glutamine-fructose-6-phosphate transaminase 2
naked mole-rat(101710677) glutamine-fructose-6-phosphate transaminase 2
sheep(101120570) glutamine-fructose-6-phosphate transaminase 2
Domestic Rabbit(100347096) glutamine-fructose-6-phosphate transaminase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013529 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013529 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013529 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005110 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005110 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005110 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005110 Rosetta Predictions human pricing
NM_001002819 Rosetta Predictions rat pricing
NM_013529 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077758 predicted 248
2 SASI_Hs02_00338998 predicted 479
3 SASI_Hs01_00077760 predicted 277
4 SASI_Hs01_00077761 predicted 2123
5 SASI_Hs01_00077763 predicted 420
6 SASI_Hs02_00338999 predicted 342
7 SASI_Hs02_00339000 predicted 227
8 SASI_Hs01_00077767 predicted 1326
9 SASI_Hs02_00339001 predicted 489
10 SASI_Hs02_00339002 predicted 1087
11 SASI_Hs01_00077759 predicted 1870
12 SASI_Hs01_00077762 predicted 580
13 SASI_Hs01_00077764 predicted 1563
14 SASI_Hs01_00077765 predicted 1533
15 SASI_Hs01_00077766 predicted 1984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002819 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052701 predicted 221
2 SASI_Rn01_00052702 predicted 457
3 SASI_Rn01_00052703 predicted 1944
4 SASI_Rn01_00052704 predicted 783
5 SASI_Rn01_00052705 predicted 248
6 SASI_Rn01_00052706 predicted 220
7 SASI_Rn02_00198003 predicted 1166
8 SASI_Rn01_00052708 predicted 491
9 SASI_Rn01_00052709 predicted 348
10 SASI_Rn02_00198004 predicted 2085
11 SASI_Rn01_00052700 predicted 759
12 SASI_Rn01_00052707 predicted 1867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322224 predicted 1560
2 SASI_Mm01_00037706 predicted 1304
3 SASI_Mm01_00037707 predicted 404
4 SASI_Mm02_00322225 predicted 1890
5 SASI_Mm01_00037708 predicted 1525
6 SASI_Mm01_00037709 predicted 710
7 SASI_Mm01_00037710 predicted 2133
8 SASI_Mm01_00037712 predicted 1108
9 SASI_Mm02_00322226 predicted 408
10 SASI_Mm01_00037713 predicted 2035
11 SASI_Mm01_00037704 predicted 1895
12 SASI_Mm01_00037705 predicted 817
13 SASI_Mm01_00037711 predicted 380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013529
VALIDATED
GFPT2 MISSION shRNA Bacterial Glycerol Stock
glutamine-fructose-6-phosphate transaminase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013529.1-718s1c1
Sequence:CCGGCCGACATGCAATATCGAGAATCTCGAGATTCTCGATATTGCATGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013529.1-458s1c1
Sequence:CCGGGCTACGAGTTTGAGTCAGAAACTCGAGTTTCTGACTCAAACTCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013529.1-1896s1c1
Sequence:CCGGCCCAATCATACTGTGTTCCAACTCGAGTTGGAACACAGTATGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013529.1-865s1c1
Sequence:CCGGCGGGTCATCTTCTTAGAAGATCTCGAGATCTTCTAAGAAGATGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013529.1-990s1c1
Sequence:CCGGGCAGCAAATAATGAAAGGTAACTCGAGTTACCTTTCATTATTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013529.3-492s21c1
Sequence:CCGGGCTACGAGTTTGAGTCAGAAACTCGAGTTTCTGACTCAAACTCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013529.3-752s21c1
Sequence:CCGGCCGACATGCAATATCGAGAATCTCGAGATTCTCGATATTGCATGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013529.3-524s21c1
Sequence:CCGGACCATCGCCAAGCTGATTAAACTCGAGTTTAATCAGCTTGGCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295446    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013529.3-2157s21c1
Sequence:CCGGTCGTCACCTGCAGTCTGATTCCTCGAGGAATCAGACTGCAGGTGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013529.3-1557s21c1
Sequence:CCGGTGATGTCTGAAGATCGAATTTCTCGAGAAATTCGATCTTCAGACATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013529
VALIDATED
GFPT2 MISSION shRNA shRNA Plasmid DNA
glutamine-fructose-6-phosphate transaminase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013529.1-718s1c1
Sequence:CCGGCCGACATGCAATATCGAGAATCTCGAGATTCTCGATATTGCATGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013529.1-458s1c1
Sequence:CCGGGCTACGAGTTTGAGTCAGAAACTCGAGTTTCTGACTCAAACTCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013529.1-1896s1c1
Sequence:CCGGCCCAATCATACTGTGTTCCAACTCGAGTTGGAACACAGTATGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013529.1-865s1c1
Sequence:CCGGCGGGTCATCTTCTTAGAAGATCTCGAGATCTTCTAAGAAGATGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013529.1-990s1c1
Sequence:CCGGGCAGCAAATAATGAAAGGTAACTCGAGTTACCTTTCATTATTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013529.3-492s21c1
Sequence:CCGGGCTACGAGTTTGAGTCAGAAACTCGAGTTTCTGACTCAAACTCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013529.3-752s21c1
Sequence:CCGGCCGACATGCAATATCGAGAATCTCGAGATTCTCGATATTGCATGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013529.3-524s21c1
Sequence:CCGGACCATCGCCAAGCTGATTAAACTCGAGTTTAATCAGCTTGGCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295446    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013529.3-2157s21c1
Sequence:CCGGTCGTCACCTGCAGTCTGATTCCTCGAGGAATCAGACTGCAGGTGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013529.3-1557s21c1
Sequence:CCGGTGATGTCTGAAGATCGAATTTCTCGAGAAATTCGATCTTCAGACATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013529
VALIDATED
GFPT2 MISSION shRNA Lentiviral Transduction Particles
glutamine-fructose-6-phosphate transaminase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013529.1-718s1c1
Sequence:CCGGCCGACATGCAATATCGAGAATCTCGAGATTCTCGATATTGCATGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013529.1-458s1c1
Sequence:CCGGGCTACGAGTTTGAGTCAGAAACTCGAGTTTCTGACTCAAACTCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013529.1-1896s1c1
Sequence:CCGGCCCAATCATACTGTGTTCCAACTCGAGTTGGAACACAGTATGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013529.1-865s1c1
Sequence:CCGGCGGGTCATCTTCTTAGAAGATCTCGAGATCTTCTAAGAAGATGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013529.1-990s1c1
Sequence:CCGGGCAGCAAATAATGAAAGGTAACTCGAGTTACCTTTCATTATTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013529.3-492s21c1
Sequence:CCGGGCTACGAGTTTGAGTCAGAAACTCGAGTTTCTGACTCAAACTCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013529.3-752s21c1
Sequence:CCGGCCGACATGCAATATCGAGAATCTCGAGATTCTCGATATTGCATGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013529.3-524s21c1
Sequence:CCGGACCATCGCCAAGCTGATTAAACTCGAGTTTAATCAGCTTGGCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295446    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013529.3-2157s21c1
Sequence:CCGGTCGTCACCTGCAGTCTGATTCCTCGAGGAATCAGACTGCAGGTGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013529.3-1557s21c1
Sequence:CCGGTGATGTCTGAAGATCGAATTTCTCGAGAAATTCGATCTTCAGACATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005110
VALIDATED
GFPT2 MISSION shRNA Bacterial Glycerol Stock
glutamine-fructose-6-phosphate transaminase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005110.1-2345s1c1
Sequence:CCGGCCAGAGGAGAAGGGAATCATTCTCGAGAATGATTCCCTTCTCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005110.1-423s1c1
Sequence:CCGGCTCAGACAAAGGCAACGAATTCTCGAGAATTCGTTGCCTTTGTCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005110.1-1971s1c1
Sequence:CCGGCGATACTGAAAGTTCCAAGTTCTCGAGAACTTGGAACTTTCAGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005110.1-2091s1c1
Sequence:CCGGCCGAGGATATGACGTTGACTTCTCGAGAAGTCAACGTCATATCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005110.1-422s1c1
Sequence:CCGGGCTCAGACAAAGGCAACGAATCTCGAGATTCGTTGCCTTTGTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005110.2-1055s21c1
Sequence:CCGGAGGTAACTTCAGTGCGTTTATCTCGAGATAAACGCACTGAAGTTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005110.2-1620s21c1
Sequence:CCGGATCCGTGGCTTGAGATCTTTACTCGAGTAAAGATCTCAAGCCACGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_005110.2-1862s21c1
Sequence:CCGGGCCCGTCATCATGGTCATTATCTCGAGATAATGACCATGATGACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005110.2-2344s21c1
Sequence:CCGGCCAGAGGAGAAGGGAATCATTCTCGAGAATGATTCCCTTCTCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005110.2-540s21c1
Sequence:CCGGACCATCGCCAAGCTGATTAAACTCGAGTTTAATCAGCTTGGCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005110
VALIDATED
GFPT2 MISSION shRNA shRNA Plasmid DNA
glutamine-fructose-6-phosphate transaminase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005110.1-2345s1c1
Sequence:CCGGCCAGAGGAGAAGGGAATCATTCTCGAGAATGATTCCCTTCTCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005110.1-423s1c1
Sequence:CCGGCTCAGACAAAGGCAACGAATTCTCGAGAATTCGTTGCCTTTGTCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005110.1-1971s1c1
Sequence:CCGGCGATACTGAAAGTTCCAAGTTCTCGAGAACTTGGAACTTTCAGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005110.1-2091s1c1
Sequence:CCGGCCGAGGATATGACGTTGACTTCTCGAGAAGTCAACGTCATATCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005110.1-422s1c1
Sequence:CCGGGCTCAGACAAAGGCAACGAATCTCGAGATTCGTTGCCTTTGTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005110.2-1055s21c1
Sequence:CCGGAGGTAACTTCAGTGCGTTTATCTCGAGATAAACGCACTGAAGTTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005110.2-1620s21c1
Sequence:CCGGATCCGTGGCTTGAGATCTTTACTCGAGTAAAGATCTCAAGCCACGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_005110.2-1862s21c1
Sequence:CCGGGCCCGTCATCATGGTCATTATCTCGAGATAATGACCATGATGACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005110.2-2344s21c1
Sequence:CCGGCCAGAGGAGAAGGGAATCATTCTCGAGAATGATTCCCTTCTCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005110.2-540s21c1
Sequence:CCGGACCATCGCCAAGCTGATTAAACTCGAGTTTAATCAGCTTGGCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005110
VALIDATED
GFPT2 MISSION shRNA Lentiviral Transduction Particles
glutamine-fructose-6-phosphate transaminase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005110.1-2345s1c1
Sequence:CCGGCCAGAGGAGAAGGGAATCATTCTCGAGAATGATTCCCTTCTCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005110.1-423s1c1
Sequence:CCGGCTCAGACAAAGGCAACGAATTCTCGAGAATTCGTTGCCTTTGTCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005110.1-1971s1c1
Sequence:CCGGCGATACTGAAAGTTCCAAGTTCTCGAGAACTTGGAACTTTCAGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005110.1-2091s1c1
Sequence:CCGGCCGAGGATATGACGTTGACTTCTCGAGAAGTCAACGTCATATCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005110.1-422s1c1
Sequence:CCGGGCTCAGACAAAGGCAACGAATCTCGAGATTCGTTGCCTTTGTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005110.2-1055s21c1
Sequence:CCGGAGGTAACTTCAGTGCGTTTATCTCGAGATAAACGCACTGAAGTTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005110.2-1620s21c1
Sequence:CCGGATCCGTGGCTTGAGATCTTTACTCGAGTAAAGATCTCAAGCCACGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_005110.2-1862s21c1
Sequence:CCGGGCCCGTCATCATGGTCATTATCTCGAGATAATGACCATGATGACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005110.2-2344s21c1
Sequence:CCGGCCAGAGGAGAAGGGAATCATTCTCGAGAATGATTCCCTTCTCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005110.2-540s21c1
Sequence:CCGGACCATCGCCAAGCTGATTAAACTCGAGTTTAATCAGCTTGGCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)