EMAIL THIS PAGE TO A FRIEND

GFRA2

GDNF family receptor alpha 2

Synonyms: GDNFRB NRTNR-ALPHA NTNRA RETL2 TRNR2
Gene ID:
Human(2675) Summary: Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. The protein encoded by this gene is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(14586) glial cell line derived neurotrophic factor family receptor alpha 2
Rat(25136) GDNF family receptor alpha 2
chicken(395993) GDNF family receptor alpha 2
cow(514036) GDNF family receptor alpha 2
Horse(100146260) GDNF family receptor alpha 2
domestic cat(101091865) GDNF family receptor alpha 2
dog(609172) GDNF family receptor alpha 2
domestic guinea pig(100727079) GDNF family receptor alpha 2
naked mole-rat(101706123) GDNF family receptor alpha 2
sheep(101119877) GDNF family receptor alpha 2
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001495 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008115 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008115 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008115 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001495 Rosetta Predictions human pricing
NM_012750 Rosetta Predictions rat pricing
NM_008115 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153105 predicted 1676
2 SASI_Hs01_00153106 predicted 1923
3 SASI_Hs01_00153107 predicted 1922
4 SASI_Hs01_00153108 predicted 1556
5 SASI_Hs01_00153109 predicted 915
6 SASI_Hs01_00153110 predicted 2535
7 SASI_Hs01_00153111 predicted 1929
8 SASI_Hs01_00153112 predicted 1560
9 SASI_Hs01_00153113 predicted 1083
10 SASI_Hs01_00153114 predicted 1570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120335 predicted 641
2 SASI_Rn01_00120336 predicted 1168
3 SASI_Rn01_00120337 predicted 1345
4 SASI_Rn01_00120338 predicted 1038
5 SASI_Rn01_00120339 predicted 1015
6 SASI_Rn01_00120340 predicted 539
7 SASI_Rn01_00120341 predicted 1004
8 SASI_Rn01_00120342 predicted 380
9 SASI_Rn01_00120343 predicted 527
10 SASI_Rn01_00120344 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008115 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022615 predicted 1640
2 SASI_Mm01_00022616 predicted 1616
3 SASI_Mm01_00022617 predicted 1140
4 SASI_Mm01_00022618 predicted 1764
5 SASI_Mm01_00022619 predicted 1616
6 SASI_Mm01_00022620 predicted 979
7 SASI_Mm01_00022621 predicted 1281
8 SASI_Mm01_00022622 predicted 1921
9 SASI_Mm01_00022623 predicted 1026
10 SASI_Mm01_00022624 predicted 1605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001495
GFRA2 MISSION shRNA Bacterial Glycerol Stock
GDNF family receptor alpha 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001495.3-1479s1c1
Sequence:CCGGGCCAACAACTCCAAAGAGTTACTCGAGTAACTCTTTGGAGTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001495.3-1151s1c1
Sequence:CCGGGTTTGACATGACACCTAACTACTCGAGTAGTTAGGTGTCATGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001495.3-752s1c1
Sequence:CCGGCCTGAATGACAACTGCAAGAACTCGAGTTCTTGCAGTTGTCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001495.3-1608s1c1
Sequence:CCGGCTGTCTGTCCTGATGCTGAAACTCGAGTTTCAGCATCAGGACAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001495.3-1490s1c1
Sequence:CCGGCAAAGAGTTAAGCATGTGCTTCTCGAGAAGCACATGCTTAACTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001495.4-2320s21c1
Sequence:CCGAAGGGCACGAGGCTCTAGAAATCTCGAGATTTCTAGAGCCTCGTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001495.4-2076s21c1
Sequence:CCGGGGGAACCGAGTCAGAATATTTCTCGAGAAATATTCTGACTCGGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001495
GFRA2 MISSION shRNA shRNA Plasmid DNA
GDNF family receptor alpha 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001495.3-1479s1c1
Sequence:CCGGGCCAACAACTCCAAAGAGTTACTCGAGTAACTCTTTGGAGTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001495.3-1151s1c1
Sequence:CCGGGTTTGACATGACACCTAACTACTCGAGTAGTTAGGTGTCATGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001495.3-752s1c1
Sequence:CCGGCCTGAATGACAACTGCAAGAACTCGAGTTCTTGCAGTTGTCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001495.3-1608s1c1
Sequence:CCGGCTGTCTGTCCTGATGCTGAAACTCGAGTTTCAGCATCAGGACAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001495.3-1490s1c1
Sequence:CCGGCAAAGAGTTAAGCATGTGCTTCTCGAGAAGCACATGCTTAACTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001495.4-2320s21c1
Sequence:CCGAAGGGCACGAGGCTCTAGAAATCTCGAGATTTCTAGAGCCTCGTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001495.4-2076s21c1
Sequence:CCGGGGGAACCGAGTCAGAATATTTCTCGAGAAATATTCTGACTCGGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001495
GFRA2 MISSION shRNA Lentiviral Transduction Particles
GDNF family receptor alpha 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001495.3-1479s1c1
Sequence:CCGGGCCAACAACTCCAAAGAGTTACTCGAGTAACTCTTTGGAGTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001495.3-1151s1c1
Sequence:CCGGGTTTGACATGACACCTAACTACTCGAGTAGTTAGGTGTCATGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001495.3-752s1c1
Sequence:CCGGCCTGAATGACAACTGCAAGAACTCGAGTTCTTGCAGTTGTCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001495.3-1608s1c1
Sequence:CCGGCTGTCTGTCCTGATGCTGAAACTCGAGTTTCAGCATCAGGACAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001495.3-1490s1c1
Sequence:CCGGCAAAGAGTTAAGCATGTGCTTCTCGAGAAGCACATGCTTAACTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001495.4-2320s21c1
Sequence:CCGAAGGGCACGAGGCTCTAGAAATCTCGAGATTTCTAGAGCCTCGTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001495.4-2076s21c1
Sequence:CCGGGGGAACCGAGTCAGAATATTTCTCGAGAAATATTCTGACTCGGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008115
VALIDATED
GFRA2 MISSION shRNA Bacterial Glycerol Stock
GDNF family receptor alpha 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008115.1-1045s1c1
Sequence:CCGGCGGAATGCCATTCAAGCCTTTCTCGAGAAAGGCTTGAATGGCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008115.1-507s1c1
Sequence:CCGGCCTGAACGACAACTGCAAGAACTCGAGTTCTTGCAGTTGTCGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008115.1-893s1c1
Sequence:CCGGCTGGCATGATTGGGTTTGATACTCGAGTATCAAACCCAATCATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008115.1-252s1c1
Sequence:CCGGCTTGCAGGAAAGCCCATTGTACTCGAGTACAATGGGCTTTCCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008115.1-903s1c1
Sequence:CCGGTGGGTTTGATATGACACCGAACTCGAGTTCGGTGTCATATCAAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008115.2-1033s21c1
Sequence:CCGGTGCAGTGTCTGCAGATCTATTCTCGAGAATAGATCTGCAGACACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008115.2-2372s21c1
Sequence:CCGGGAACCTTTCTCCTCCCAAATTCTCGAGAATTTGGGAGGAGAAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008115.2-1633s21c1
Sequence:CCGGTTGATATGACACCGAACTATGCTCGAGCATAGTTCGGTGTCATATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008115.2-1232s21c1
Sequence:CCGGCCTGAACGACAACTGCAAGAACTCGAGTTCTTGCAGTTGTCGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008115.2-977s21c1
Sequence:CCGGCTTGCAGGAAAGCCCATTGTACTCGAGTACAATGGGCTTTCCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008115.2-1989s21c1
Sequence:CCGGTTCACAGAGCTCACGACAAATCTCGAGATTTGTCGTGAGCTCTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008115.2-2125s21c1
Sequence:CCGGTTGGAACCCAGCACGAAAGTTCTCGAGAACTTTCGTGCTGGGTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008115
VALIDATED
GFRA2 MISSION shRNA shRNA Plasmid DNA
GDNF family receptor alpha 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008115.1-1045s1c1
Sequence:CCGGCGGAATGCCATTCAAGCCTTTCTCGAGAAAGGCTTGAATGGCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008115.1-507s1c1
Sequence:CCGGCCTGAACGACAACTGCAAGAACTCGAGTTCTTGCAGTTGTCGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008115.1-893s1c1
Sequence:CCGGCTGGCATGATTGGGTTTGATACTCGAGTATCAAACCCAATCATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008115.1-252s1c1
Sequence:CCGGCTTGCAGGAAAGCCCATTGTACTCGAGTACAATGGGCTTTCCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008115.1-903s1c1
Sequence:CCGGTGGGTTTGATATGACACCGAACTCGAGTTCGGTGTCATATCAAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008115.2-1033s21c1
Sequence:CCGGTGCAGTGTCTGCAGATCTATTCTCGAGAATAGATCTGCAGACACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008115.2-2372s21c1
Sequence:CCGGGAACCTTTCTCCTCCCAAATTCTCGAGAATTTGGGAGGAGAAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008115.2-1633s21c1
Sequence:CCGGTTGATATGACACCGAACTATGCTCGAGCATAGTTCGGTGTCATATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008115.2-1232s21c1
Sequence:CCGGCCTGAACGACAACTGCAAGAACTCGAGTTCTTGCAGTTGTCGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008115.2-977s21c1
Sequence:CCGGCTTGCAGGAAAGCCCATTGTACTCGAGTACAATGGGCTTTCCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008115.2-1989s21c1
Sequence:CCGGTTCACAGAGCTCACGACAAATCTCGAGATTTGTCGTGAGCTCTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008115.2-2125s21c1
Sequence:CCGGTTGGAACCCAGCACGAAAGTTCTCGAGAACTTTCGTGCTGGGTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008115
VALIDATED
GFRA2 MISSION shRNA Lentiviral Transduction Particles
GDNF family receptor alpha 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008115.1-1045s1c1
Sequence:CCGGCGGAATGCCATTCAAGCCTTTCTCGAGAAAGGCTTGAATGGCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008115.1-507s1c1
Sequence:CCGGCCTGAACGACAACTGCAAGAACTCGAGTTCTTGCAGTTGTCGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008115.1-893s1c1
Sequence:CCGGCTGGCATGATTGGGTTTGATACTCGAGTATCAAACCCAATCATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008115.1-252s1c1
Sequence:CCGGCTTGCAGGAAAGCCCATTGTACTCGAGTACAATGGGCTTTCCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008115.1-903s1c1
Sequence:CCGGTGGGTTTGATATGACACCGAACTCGAGTTCGGTGTCATATCAAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008115.2-1033s21c1
Sequence:CCGGTGCAGTGTCTGCAGATCTATTCTCGAGAATAGATCTGCAGACACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008115.2-2372s21c1
Sequence:CCGGGAACCTTTCTCCTCCCAAATTCTCGAGAATTTGGGAGGAGAAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008115.2-1633s21c1
Sequence:CCGGTTGATATGACACCGAACTATGCTCGAGCATAGTTCGGTGTCATATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008115.2-1232s21c1
Sequence:CCGGCCTGAACGACAACTGCAAGAACTCGAGTTCTTGCAGTTGTCGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008115.2-977s21c1
Sequence:CCGGCTTGCAGGAAAGCCCATTGTACTCGAGTACAATGGGCTTTCCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008115.2-1989s21c1
Sequence:CCGGTTCACAGAGCTCACGACAAATCTCGAGATTTGTCGTGAGCTCTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008115.2-2125s21c1
Sequence:CCGGTTGGAACCCAGCACGAAAGTTCTCGAGAACTTTCGTGCTGGGTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks