EMAIL THIS PAGE TO A FRIEND

GFRA3

GDNF family receptor alpha 3

69 Gene Product Result for
UniProtKB ID: O60609, B2RA36, B4DMY9, Q6UW20, Q8IUZ2
Gene ID:
Human(2676) Summary: The protein encoded by this gene is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor and a member of the GDNF receptor family. It forms a signaling receptor complex with RET tyrosine kinase receptor and binds the ligand, artemin. [provided by RefSeq, Jul 2008]
Mouse(14587) glial cell line derived neurotrophic factor family receptor alpha 3
Rat(84422) GDNF family receptor alpha 3
Zebrafish(556647) GDNF family receptor alpha 3
chicken(416353) GDNF family receptor alpha 3
dog(481527) GDNF family receptor alpha 3
cow(540009) GDNF family receptor alpha 3
domestic cat(101086693) GDNF family receptor alpha 3
sheep(101109876) GDNF family receptor alpha 3
naked mole-rat(101712114) GDNF family receptor alpha 3
domestic guinea pig(100729758) GDNF family receptor alpha 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001496 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010280 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010280 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010280 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001496 Rosetta Predictions human pricing
NM_053398 Rosetta Predictions rat pricing
NM_010280 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111658 predicted 1226
2 SASI_Hs01_00111660 predicted 1464
3 SASI_Hs01_00111661 predicted 1120
4 SASI_Hs02_00331986 predicted 1629
5 SASI_Hs01_00111662 predicted 1638
6 SASI_Hs01_00111664 predicted 636
7 SASI_Hs01_00111665 predicted 916
8 SASI_Hs01_00111666 predicted 964
9 SASI_Hs01_00111667 predicted 1220
10 SASI_Hs02_00331987 predicted 592
11 SASI_Hs01_00111659 predicted 1633
12 SASI_Hs01_00111663 predicted 1551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053398 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035635 predicted 372
2 SASI_Rn02_00265899 predicted 1725
3 SASI_Rn01_00035636 predicted 1500
4 SASI_Rn01_00035637 predicted 962
5 SASI_Rn02_00265900 predicted 1428
6 SASI_Rn01_00035638 predicted 548
7 SASI_Rn01_00035639 predicted 1487
8 SASI_Rn01_00035641 predicted 383
9 SASI_Rn01_00035642 predicted 531
10 SASI_Rn01_00035644 predicted 424
11 SASI_Rn01_00035640 predicted 953
12 SASI_Rn01_00035643 predicted 1488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010280 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103254 predicted 482
2 SASI_Mm01_00103255 predicted 1619
3 SASI_Mm01_00103256 predicted 1188
4 SASI_Mm02_00318218 predicted 257
5 SASI_Mm01_00103257 predicted 1037
6 SASI_Mm01_00103258 predicted 535
7 SASI_Mm02_00318219 predicted 635
8 SASI_Mm01_00103259 predicted 497
9 SASI_Mm01_00103260 predicted 1058
10 SASI_Mm01_00103261 predicted 1615
11 SASI_Mm01_00103262 predicted 532
12 SASI_Mm01_00103263 predicted 1056
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001496
GFRA3 MISSION shRNA Bacterial Glycerol Stock
GDNF family receptor alpha 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001496.3-923s21c1
Sequence:CCGGCAGATCACGCCTGGTGGATTTCTCGAGAAATCCACCAGGCGTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001496.3-334s21c1
Sequence:CCGGATTCCTGCACCTCTAGCATAACTCGAGTTATGCTAGAGGTGCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001496.3-1456s21c1
Sequence:CCGGACAGGAGAAGCTAAGGGTTATCTCGAGATAACCCTTAGCTTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001496.3-1633s21c1
Sequence:CCGGGGATCACCAGAATCTAATAAGCTCGAGCTTATTAGATTCTGGTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001496.3-1171s1c1
Sequence:CCGGCCATTGCAGCTAAGATGCGTTCTCGAGAACGCATCTTAGCTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001496.3-471s1c1
Sequence:CCGGGTTGCCTGCTTGGACATCTATCTCGAGATAGATGTCCAAGCAGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001496.3-641s1c1
Sequence:CCGGGCTGTGTACTCTCAATGACAACTCGAGTTGTCATTGAGAGTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001496.3-516s1c1
Sequence:CCGGCTTGGTAACTATGAGCTGGATCTCGAGATCCAGCTCATAGTTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001496
GFRA3 MISSION shRNA shRNA Plasmid DNA
GDNF family receptor alpha 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001496.3-923s21c1
Sequence:CCGGCAGATCACGCCTGGTGGATTTCTCGAGAAATCCACCAGGCGTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001496.3-334s21c1
Sequence:CCGGATTCCTGCACCTCTAGCATAACTCGAGTTATGCTAGAGGTGCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001496.3-1456s21c1
Sequence:CCGGACAGGAGAAGCTAAGGGTTATCTCGAGATAACCCTTAGCTTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001496.3-1633s21c1
Sequence:CCGGGGATCACCAGAATCTAATAAGCTCGAGCTTATTAGATTCTGGTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001496.3-1171s1c1
Sequence:CCGGCCATTGCAGCTAAGATGCGTTCTCGAGAACGCATCTTAGCTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001496.3-471s1c1
Sequence:CCGGGTTGCCTGCTTGGACATCTATCTCGAGATAGATGTCCAAGCAGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001496.3-641s1c1
Sequence:CCGGGCTGTGTACTCTCAATGACAACTCGAGTTGTCATTGAGAGTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001496.3-516s1c1
Sequence:CCGGCTTGGTAACTATGAGCTGGATCTCGAGATCCAGCTCATAGTTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001496
GFRA3 MISSION shRNA Lentiviral Transduction Particles
GDNF family receptor alpha 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001496.3-923s21c1
Sequence:CCGGCAGATCACGCCTGGTGGATTTCTCGAGAAATCCACCAGGCGTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001496.3-334s21c1
Sequence:CCGGATTCCTGCACCTCTAGCATAACTCGAGTTATGCTAGAGGTGCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001496.3-1456s21c1
Sequence:CCGGACAGGAGAAGCTAAGGGTTATCTCGAGATAACCCTTAGCTTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001496.3-1633s21c1
Sequence:CCGGGGATCACCAGAATCTAATAAGCTCGAGCTTATTAGATTCTGGTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001496.3-1171s1c1
Sequence:CCGGCCATTGCAGCTAAGATGCGTTCTCGAGAACGCATCTTAGCTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001496.3-471s1c1
Sequence:CCGGGTTGCCTGCTTGGACATCTATCTCGAGATAGATGTCCAAGCAGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001496.3-641s1c1
Sequence:CCGGGCTGTGTACTCTCAATGACAACTCGAGTTGTCATTGAGAGTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001496.3-516s1c1
Sequence:CCGGCTTGGTAACTATGAGCTGGATCTCGAGATCCAGCTCATAGTTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010280
GFRA3 MISSION shRNA Bacterial Glycerol Stock
GDNF family receptor alpha 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010280.2-1752s1c1
Sequence:CCGGCGTCCCTTTGAATGGAAGATACTCGAGTATCTTCCATTCAAAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010280.2-895s1c1
Sequence:CCGGCCACTGTCATCCTATGGACATCTCGAGATGTCCATAGGATGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010280.2-226s1c1
Sequence:CCGGCAGAAAGAAATGCGAGGCTAACTCGAGTTAGCCTCGCATTTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010280.2-227s1c1
Sequence:CCGGAGAAAGAAATGCGAGGCTAATCTCGAGATTAGCCTCGCATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010280.2-416s1c1
Sequence:CCGGGCTACCTGTCTGGACATTTATCTCGAGATAAATGTCCAGACAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010280
GFRA3 MISSION shRNA shRNA Plasmid DNA
GDNF family receptor alpha 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010280.2-1752s1c1
Sequence:CCGGCGTCCCTTTGAATGGAAGATACTCGAGTATCTTCCATTCAAAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010280.2-895s1c1
Sequence:CCGGCCACTGTCATCCTATGGACATCTCGAGATGTCCATAGGATGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010280.2-226s1c1
Sequence:CCGGCAGAAAGAAATGCGAGGCTAACTCGAGTTAGCCTCGCATTTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010280.2-227s1c1
Sequence:CCGGAGAAAGAAATGCGAGGCTAATCTCGAGATTAGCCTCGCATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010280.2-416s1c1
Sequence:CCGGGCTACCTGTCTGGACATTTATCTCGAGATAAATGTCCAGACAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010280
GFRA3 MISSION shRNA Lentiviral Transduction Particles
GDNF family receptor alpha 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010280.2-1752s1c1
Sequence:CCGGCGTCCCTTTGAATGGAAGATACTCGAGTATCTTCCATTCAAAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010280.2-895s1c1
Sequence:CCGGCCACTGTCATCCTATGGACATCTCGAGATGTCCATAGGATGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010280.2-226s1c1
Sequence:CCGGCAGAAAGAAATGCGAGGCTAACTCGAGTTAGCCTCGCATTTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010280.2-227s1c1
Sequence:CCGGAGAAAGAAATGCGAGGCTAATCTCGAGATTAGCCTCGCATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010280.2-416s1c1
Sequence:CCGGGCTACCTGTCTGGACATTTATCTCGAGATAAATGTCCAGACAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks