EMAIL THIS PAGE TO A FRIEND

GFRA4

GDNF family receptor alpha 4

63 Gene Product Result for
UniProtKB ID: Q9GZZ7, Q5JT74, Q9H191, Q9H192
Gene ID:
Human(64096) Summary: The protein encoded by this gene is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor for persephin, and mediates activation of the RET tyrosine kinase receptor. This gene is a candidate gene for RET-associated diseases. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(14588) glial cell line derived neurotrophic factor family receptor alpha 4
Rat(66023) GDNF family receptor alpha 4
domestic guinea pig(100714325) GDNF family receptor alpha 4
naked mole-rat(101697792) GDNF family receptor alpha 4
sheep(101111478) GDNF family receptor alpha 4
Zebrafish(100144564) GDNF family receptor alpha 4
chicken(395839) GDNF family receptor alpha 4
dog(609182) GDNF family receptor alpha 4
cow(618480) GDNF family receptor alpha 4
domestic cat(101093766) GDNF family receptor alpha 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022139 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020014 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020014 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020014 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022139 Rosetta Predictions human pricing
NM_145762 Rosetta Predictions human pricing
NM_023967 Rosetta Predictions rat pricing
NM_020014 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059964 predicted 1041
2 SASI_Hs01_00059965 predicted 1101
3 SASI_Hs01_00059966 predicted 1159
4 SASI_Hs01_00059967 predicted 942
5 SASI_Hs01_00059968 predicted 1032
6 SASI_Hs01_00059970 predicted 1163
7 SASI_Hs01_00059971 predicted 821
8 SASI_Hs01_00059972 predicted 1051
9 SASI_Hs01_00059973 predicted 1171
10 SASI_Hs02_00355549 predicted 1022
11 SASI_Hs01_00059969 predicted 1180
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224543 predicted 1128
2 SASI_Hs01_00224544 predicted 1182
3 SASI_Hs01_00224545 predicted 1255
4 SASI_Hs01_00224546 predicted 1024
5 SASI_Hs01_00224547 predicted 1118
6 SASI_Hs01_00224549 predicted 1249
7 SASI_Hs01_00224550 predicted 906
8 SASI_Hs01_00224551 predicted 1143
9 SASI_Hs01_00224552 predicted 1258
10 SASI_Hs02_00365347 predicted 1110
11 SASI_Hs01_00224548 predicted 1269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263776 predicted 680
2 SASI_Rn01_00037216 predicted 274
3 SASI_Rn01_00037217 predicted 549
4 SASI_Rn01_00037218 predicted 566
5 SASI_Rn01_00037219 predicted 327
6 SASI_Rn01_00037220 predicted 735
7 SASI_Rn01_00037221 predicted 668
8 SASI_Rn01_00037222 predicted 656
9 SASI_Rn01_00037223 predicted 639
10 SASI_Rn01_00037224 predicted 201
11 SASI_Rn01_00037225 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020014 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192828 predicted 507
2 SASI_Mm01_00192829 predicted 237
3 SASI_Mm01_00192830 predicted 614
4 SASI_Mm01_00192831 predicted 267
5 SASI_Mm01_00192832 predicted 637
6 SASI_Mm01_00192833 predicted 510
7 SASI_Mm01_00192834 predicted 644
8 SASI_Mm01_00192835 predicted 520
9 SASI_Mm01_00192836 predicted 630
10 SASI_Mm01_00192837 predicted 668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022139
GFRA4 MISSION shRNA Bacterial Glycerol Stock
GDNF family receptor alpha 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022139.2-585s1c1
Sequence:CCGGGCGTGAGGACTGCGAAGCCTTCTCGAGAAGGCTTCGCAGTCCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022139.2-615s1c1
Sequence:CCGGCTTTACCAGGAACCGCTGCTTCTCGAGAAGCAGCGGTTCCTGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022139.2-768s1c1
Sequence:CCGGGCTCTCCATACTTCCTGTCCTCTCGAGAGGACAGGAAGTATGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022139.2-354s1c1
Sequence:CCGGTGAGCCCTTAAACTTCTGCGACTCGAGTCGCAGAAGTTTAAGGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022139.3-757s21c1
Sequence:CCGGAGACGCTCCCTGCTCTCCATACTCGAGTATGGAGAGCAGGGAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022139.3-1229s21c1
Sequence:CCGGTAAGGAATCCATCGGACAAGACTCGAGTCTTGTCCGATGGATTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022139.3-119s21c1
Sequence:CCGGAGCGTTTGCGCTCCGAGTATGCTCGAGCATACTCGGAGCGCAAACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022139.3-518s21c1
Sequence:CCGGCTAACTACGTGGACAACGTGACTCGAGTCACGTTGTCCACGTAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022139.3-631s21c1
Sequence:CCGGTGCTTGGATGGTGCCATTCAGCTCGAGCTGAATGGCACCATCCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022139
GFRA4 MISSION shRNA shRNA Plasmid DNA
GDNF family receptor alpha 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022139.2-585s1c1
Sequence:CCGGGCGTGAGGACTGCGAAGCCTTCTCGAGAAGGCTTCGCAGTCCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022139.2-615s1c1
Sequence:CCGGCTTTACCAGGAACCGCTGCTTCTCGAGAAGCAGCGGTTCCTGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022139.2-768s1c1
Sequence:CCGGGCTCTCCATACTTCCTGTCCTCTCGAGAGGACAGGAAGTATGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022139.2-354s1c1
Sequence:CCGGTGAGCCCTTAAACTTCTGCGACTCGAGTCGCAGAAGTTTAAGGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022139.3-757s21c1
Sequence:CCGGAGACGCTCCCTGCTCTCCATACTCGAGTATGGAGAGCAGGGAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022139.3-1229s21c1
Sequence:CCGGTAAGGAATCCATCGGACAAGACTCGAGTCTTGTCCGATGGATTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022139.3-119s21c1
Sequence:CCGGAGCGTTTGCGCTCCGAGTATGCTCGAGCATACTCGGAGCGCAAACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022139.3-518s21c1
Sequence:CCGGCTAACTACGTGGACAACGTGACTCGAGTCACGTTGTCCACGTAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022139.3-631s21c1
Sequence:CCGGTGCTTGGATGGTGCCATTCAGCTCGAGCTGAATGGCACCATCCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022139
GFRA4 MISSION shRNA Lentiviral Transduction Particles
GDNF family receptor alpha 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022139.2-585s1c1
Sequence:CCGGGCGTGAGGACTGCGAAGCCTTCTCGAGAAGGCTTCGCAGTCCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022139.2-615s1c1
Sequence:CCGGCTTTACCAGGAACCGCTGCTTCTCGAGAAGCAGCGGTTCCTGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022139.2-768s1c1
Sequence:CCGGGCTCTCCATACTTCCTGTCCTCTCGAGAGGACAGGAAGTATGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022139.2-354s1c1
Sequence:CCGGTGAGCCCTTAAACTTCTGCGACTCGAGTCGCAGAAGTTTAAGGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022139.3-757s21c1
Sequence:CCGGAGACGCTCCCTGCTCTCCATACTCGAGTATGGAGAGCAGGGAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022139.3-1229s21c1
Sequence:CCGGTAAGGAATCCATCGGACAAGACTCGAGTCTTGTCCGATGGATTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022139.3-119s21c1
Sequence:CCGGAGCGTTTGCGCTCCGAGTATGCTCGAGCATACTCGGAGCGCAAACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022139.3-518s21c1
Sequence:CCGGCTAACTACGTGGACAACGTGACTCGAGTCACGTTGTCCACGTAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022139.3-631s21c1
Sequence:CCGGTGCTTGGATGGTGCCATTCAGCTCGAGCTGAATGGCACCATCCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020014
GFRA4 MISSION shRNA Bacterial Glycerol Stock
GDNF family receptor alpha 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020014.1-630s1c1
Sequence:CCGGGCGCGAAGAATGCGAAGCCTTCTCGAGAAGGCTTCGCATTCTTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020014.1-647s1c1
Sequence:CCGGCCTTCCGCAAGCTCTTTACAACTCGAGTTGTAAAGAGCTTGCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020014.1-79s1c1
Sequence:CCGGGCGAGCTTTACCGACGGGAATCTCGAGATTCCCGTCGGTAAAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020014.1-686s1c1
Sequence:CCGGGTGCCATACAAGCCTTTGACACTCGAGTGTCAAAGGCTTGTATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020014.1-513s1c1
Sequence:CCGGCCCGCGTTGTCTGCGCGTCTACTCGAGTAGACGCGCAGACAACGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020014.1-705s21c1
Sequence:CCGGCAGCTTGCAGCCATCAGTTCTCTCGAGAGAACTGATGGCTGCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020014.1-677s21c1
Sequence:CCGGGCTTGGATGGTGCCATACAAGCTCGAGCTTGTATGGCACCATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020014
GFRA4 MISSION shRNA shRNA Plasmid DNA
GDNF family receptor alpha 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020014.1-630s1c1
Sequence:CCGGGCGCGAAGAATGCGAAGCCTTCTCGAGAAGGCTTCGCATTCTTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020014.1-647s1c1
Sequence:CCGGCCTTCCGCAAGCTCTTTACAACTCGAGTTGTAAAGAGCTTGCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020014.1-79s1c1
Sequence:CCGGGCGAGCTTTACCGACGGGAATCTCGAGATTCCCGTCGGTAAAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020014.1-686s1c1
Sequence:CCGGGTGCCATACAAGCCTTTGACACTCGAGTGTCAAAGGCTTGTATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020014.1-513s1c1
Sequence:CCGGCCCGCGTTGTCTGCGCGTCTACTCGAGTAGACGCGCAGACAACGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020014.1-705s21c1
Sequence:CCGGCAGCTTGCAGCCATCAGTTCTCTCGAGAGAACTGATGGCTGCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020014.1-677s21c1
Sequence:CCGGGCTTGGATGGTGCCATACAAGCTCGAGCTTGTATGGCACCATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020014
GFRA4 MISSION shRNA Lentiviral Transduction Particles
GDNF family receptor alpha 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020014.1-630s1c1
Sequence:CCGGGCGCGAAGAATGCGAAGCCTTCTCGAGAAGGCTTCGCATTCTTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020014.1-647s1c1
Sequence:CCGGCCTTCCGCAAGCTCTTTACAACTCGAGTTGTAAAGAGCTTGCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020014.1-79s1c1
Sequence:CCGGGCGAGCTTTACCGACGGGAATCTCGAGATTCCCGTCGGTAAAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020014.1-686s1c1
Sequence:CCGGGTGCCATACAAGCCTTTGACACTCGAGTGTCAAAGGCTTGTATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020014.1-513s1c1
Sequence:CCGGCCCGCGTTGTCTGCGCGTCTACTCGAGTAGACGCGCAGACAACGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020014.1-705s21c1
Sequence:CCGGCAGCTTGCAGCCATCAGTTCTCTCGAGAGAACTGATGGCTGCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020014.1-677s21c1
Sequence:CCGGGCTTGGATGGTGCCATACAAGCTCGAGCTTGTATGGCACCATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks