EMAIL THIS PAGE TO A FRIEND

GFRAL

GDNF family receptor alpha like

57 Gene Product Result for
Synonyms: C6orf144 GRAL UNQ9356 bA360D14.1
UniProtKB ID: Q6UXV0, Q5VTF6
Gene ID:
Mouse(404194) GDNF family receptor alpha like
Rat(501023) GDNF family receptor alpha like
chicken(421887) GDNF family receptor alpha like
domestic cat(101097066) GDNF family receptor alpha like
dog(481851) GDNF family receptor alpha like
cow(531956) GDNF family receptor alpha like
sheep(101113803) GDNF family receptor alpha like
naked mole-rat(101706249) GDNF family receptor alpha like
domestic guinea pig(100733076) GDNF family receptor alpha like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_205844 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_205844 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_205844 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207410 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_371826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371826 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207410 Rosetta Predictions human pricing
XM_001058402 Rosetta Predictions rat pricing
XM_576432 Rosetta Predictions rat pricing
NM_205844 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137745 predicted 775
2 SASI_Hs02_00374035 predicted 394
3 SASI_Hs01_00137746 predicted 952
4 SASI_Hs01_00137747 predicted 729
5 SASI_Hs01_00137748 predicted 301
6 SASI_Hs01_00137749 predicted 977
7 SASI_Hs01_00137750 predicted 850
8 SASI_Hs01_00137751 predicted 789
9 SASI_Hs01_00137752 predicted 966
10 SASI_Hs02_00374036 predicted 882
11 SASI_Hs01_00137744 predicted 347
12 SASI_Hs01_00137753 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289593 predicted 918
2 SASI_Rn02_00289594 predicted 277
3 SASI_Rn02_00289595 predicted 781
4 SASI_Rn02_00289596 predicted 903
5 SASI_Rn02_00289597 predicted 696
6 SASI_Rn02_00289598 predicted 390
7 SASI_Rn02_00289599 predicted 292
8 SASI_Rn02_00289600 predicted 555
9 SASI_Rn02_00289601 predicted 911
10 SASI_Rn02_00289602 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576432 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405310 predicted 916
2 SASI_Rn02_00405311 predicted 273
3 SASI_Rn02_00405312 predicted 789
4 SASI_Rn02_00405313 predicted 903
5 SASI_Rn02_00405314 predicted 703
6 SASI_Rn02_00405315 predicted 395
7 SASI_Rn02_00405316 predicted 288
8 SASI_Rn02_00405317 predicted 556
9 SASI_Rn02_00405318 predicted 918
10 SASI_Rn02_00405319 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191922 predicted 981
2 SASI_Mm01_00191923 predicted 361
3 SASI_Mm01_00191924 predicted 960
4 SASI_Mm01_00191926 predicted 977
5 SASI_Mm01_00191928 predicted 777
6 SASI_Mm01_00191929 predicted 895
7 SASI_Mm01_00191930 predicted 1300
8 SASI_Mm02_00351801 predicted 1083
9 SASI_Mm01_00191931 predicted 255
10 SASI_Mm02_00351802 predicted 1265
11 SASI_Mm01_00191925 predicted 1274
12 SASI_Mm01_00191927 predicted 1311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_205844
GFRAL MISSION shRNA Bacterial Glycerol Stock
GDNF family receptor alpha like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205844.3-1126s21c1
Sequence:CCGGCTTCATAGCAAATCGTGTTTCCTCGAGGAAACACGATTTGCTATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205844.3-1432s21c1
Sequence:CCGGATTTGCCAATAACGCAATTTACTCGAGTAAATTGCGTTATTGGCAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205844.1-296s1c1
Sequence:CCGGCCAACAAATGATTGTGCACATCTCGAGATGTGCACAATCATTTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205844.1-580s1c1
Sequence:CCGGGAATCTAACTACTACTCCTTTCTCGAGAAAGGAGTAGTAGTTAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205844.1-897s1c1
Sequence:CCGGGCCTCAGTGTAATTCACACTTCTCGAGAAGTGTGAATTACACTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205844.1-1340s1c1
Sequence:CCGGGTGATGCTCAAGTTAAGGATACTCGAGTATCCTTAACTTGAGCATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205844.1-1258s1c1
Sequence:CCGGGACTGGATTCAATTCTTTCTTCTCGAGAAGAAAGAATTGAATCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_205844
GFRAL MISSION shRNA shRNA Plasmid DNA
GDNF family receptor alpha like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205844.3-1126s21c1
Sequence:CCGGCTTCATAGCAAATCGTGTTTCCTCGAGGAAACACGATTTGCTATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205844.3-1432s21c1
Sequence:CCGGATTTGCCAATAACGCAATTTACTCGAGTAAATTGCGTTATTGGCAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205844.1-296s1c1
Sequence:CCGGCCAACAAATGATTGTGCACATCTCGAGATGTGCACAATCATTTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205844.1-580s1c1
Sequence:CCGGGAATCTAACTACTACTCCTTTCTCGAGAAAGGAGTAGTAGTTAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205844.1-897s1c1
Sequence:CCGGGCCTCAGTGTAATTCACACTTCTCGAGAAGTGTGAATTACACTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205844.1-1340s1c1
Sequence:CCGGGTGATGCTCAAGTTAAGGATACTCGAGTATCCTTAACTTGAGCATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205844.1-1258s1c1
Sequence:CCGGGACTGGATTCAATTCTTTCTTCTCGAGAAGAAAGAATTGAATCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_205844
GFRAL MISSION shRNA Lentiviral Transduction Particles
GDNF family receptor alpha like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205844.3-1126s21c1
Sequence:CCGGCTTCATAGCAAATCGTGTTTCCTCGAGGAAACACGATTTGCTATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205844.3-1432s21c1
Sequence:CCGGATTTGCCAATAACGCAATTTACTCGAGTAAATTGCGTTATTGGCAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205844.1-296s1c1
Sequence:CCGGCCAACAAATGATTGTGCACATCTCGAGATGTGCACAATCATTTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205844.1-580s1c1
Sequence:CCGGGAATCTAACTACTACTCCTTTCTCGAGAAAGGAGTAGTAGTTAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205844.1-897s1c1
Sequence:CCGGGCCTCAGTGTAATTCACACTTCTCGAGAAGTGTGAATTACACTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205844.1-1340s1c1
Sequence:CCGGGTGATGCTCAAGTTAAGGATACTCGAGTATCCTTAACTTGAGCATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205844.1-1258s1c1
Sequence:CCGGGACTGGATTCAATTCTTTCTTCTCGAGAAGAAAGAATTGAATCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207410
GFRAL MISSION shRNA Bacterial Glycerol Stock
GDNF family receptor alpha like
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000419676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207410.2-174s21c1
Sequence:CCGGCAATGCTTACGTGATGCAAATCTCGAGATTTGCATCACGTAAGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207410.2-403s21c1
Sequence:CCGGATAACGTGAAAGAGGATAAATCTCGAGATTTATCCTCTTTCACGTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207410
GFRAL MISSION shRNA shRNA Plasmid DNA
GDNF family receptor alpha like
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000419676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207410.2-174s21c1
Sequence:CCGGCAATGCTTACGTGATGCAAATCTCGAGATTTGCATCACGTAAGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207410.2-403s21c1
Sequence:CCGGATAACGTGAAAGAGGATAAATCTCGAGATTTATCCTCTTTCACGTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207410
GFRAL MISSION shRNA Lentiviral Transduction Particles
GDNF family receptor alpha like
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000419676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207410.2-174s21c1
Sequence:CCGGCAATGCTTACGTGATGCAAATCTCGAGATTTGCATCACGTAAGCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207410.2-403s21c1
Sequence:CCGGATAACGTGAAAGAGGATAAATCTCGAGATTTATCCTCTTTCACGTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371826
GFRAL MISSION shRNA Bacterial Glycerol Stock
GDNF family receptor alpha like
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371826.1-555s1c1
Sequence:CCGGGCAAATGGAAATCCGTGTGATCTCGAGATCACACGGATTTCCATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371826.1-652s1c1
Sequence:CCGGGTGACTGTGCTCAATCTGATACTCGAGTATCAGATTGAGCACAGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371826.1-594s1c1
Sequence:CCGGGCCATACGGTTCTTCTATCAACTCGAGTTGATAGAAGAACCGTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371826.1-340s1c1
Sequence:CCGGGCACTGATGACTTCTATTGTACTCGAGTACAATAGAAGTCATCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371826.1-1683s1c1
Sequence:CCGGCAACCACGTCAAGACAACAATCTCGAGATTGTTGTCTTGACGTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371826.1-444s1c1
Sequence:CCGGCGTTCCCATCATGGATTCAAACTCGAGTTTGAATCCATGATGGGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371826
GFRAL MISSION shRNA shRNA Plasmid DNA
GDNF family receptor alpha like
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371826.1-555s1c1
Sequence:CCGGGCAAATGGAAATCCGTGTGATCTCGAGATCACACGGATTTCCATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371826.1-652s1c1
Sequence:CCGGGTGACTGTGCTCAATCTGATACTCGAGTATCAGATTGAGCACAGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371826.1-594s1c1
Sequence:CCGGGCCATACGGTTCTTCTATCAACTCGAGTTGATAGAAGAACCGTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371826.1-340s1c1
Sequence:CCGGGCACTGATGACTTCTATTGTACTCGAGTACAATAGAAGTCATCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371826.1-1683s1c1
Sequence:CCGGCAACCACGTCAAGACAACAATCTCGAGATTGTTGTCTTGACGTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371826.1-444s1c1
Sequence:CCGGCGTTCCCATCATGGATTCAAACTCGAGTTTGAATCCATGATGGGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371826
GFRAL MISSION shRNA Lentiviral Transduction Particles
GDNF family receptor alpha like
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371826.1-555s1c1
Sequence:CCGGGCAAATGGAAATCCGTGTGATCTCGAGATCACACGGATTTCCATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371826.1-652s1c1
Sequence:CCGGGTGACTGTGCTCAATCTGATACTCGAGTATCAGATTGAGCACAGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371826.1-594s1c1
Sequence:CCGGGCCATACGGTTCTTCTATCAACTCGAGTTGATAGAAGAACCGTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371826.1-340s1c1
Sequence:CCGGGCACTGATGACTTCTATTGTACTCGAGTACAATAGAAGTCATCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371826.1-1683s1c1
Sequence:CCGGCAACCACGTCAAGACAACAATCTCGAGATTGTTGTCTTGACGTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371826.1-444s1c1
Sequence:CCGGCGTTCCCATCATGGATTCAAACTCGAGTTTGAATCCATGATGGGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)