EMAIL THIS PAGE TO A FRIEND

GGA1

golgi-associated, gamma adaptin ear containing, ARF binding protein 1

Gene ID:
Human(26088) Summary: This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) protein family. Members of this family are ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(106039) golgi associated, gamma adaptin ear containing, ARF binding protein 1
Rat(300066) golgi associated, gamma adaptin ear containing, ARF binding protein 1
Zebrafish(798361) golgi associated, gamma adaptin ear containing, ARF binding protein 1
cow(534634) golgi-associated, gamma adaptin ear containing, ARF binding protein 1
domestic cat(101093371) golgi-associated, gamma adaptin ear containing, ARF binding protein 1
dog(481266) golgi-associated, gamma adaptin ear containing, ARF binding protein 1
chicken(418039) golgi-associated, gamma adaptin ear containing, ARF binding protein 1
sheep(101123025) golgi-associated, gamma adaptin ear containing, ARF binding protein 1
domestic guinea pig(100721334) golgi-associated, gamma adaptin ear containing, ARF binding protein 1
naked mole-rat(101720393) golgi-associated, gamma adaptin ear containing, ARF binding protein 1
143 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145929 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145929 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145929 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001560 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001560 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001560 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001560 Rosetta Predictions human pricing
NM_001001561 Rosetta Predictions human pricing
NM_013365 Rosetta Predictions human pricing
NM_001011994 Rosetta Predictions rat pricing
XM_576308 Rosetta Predictions rat pricing
NM_145929 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063263 predicted 1765
2 SASI_Hs01_00063265 predicted 617
3 SASI_Hs01_00063266 predicted 1004
4 SASI_Hs01_00063267 predicted 984
5 SASI_Hs01_00063268 predicted 1022
6 SASI_Hs01_00063269 predicted 2384
7 SASI_Hs01_00063270 predicted 1420
8 SASI_Hs01_00063271 predicted 1235
9 SASI_Hs02_00303825 predicted 850
10 SASI_Hs01_00063272 predicted 1169
11 SASI_Hs01_00063264 predicted 2106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207863 predicted 927
2 SASI_Hs01_00207864 predicted 385
3 SASI_Hs01_00207865 predicted 879
4 SASI_Hs01_00207866 predicted 1050
5 SASI_Hs01_00207867 predicted 856
6 SASI_Hs01_00207868 predicted 922
7 SASI_Hs02_00303826 predicted 382
8 SASI_Hs01_00207870 predicted 981
9 SASI_Hs01_00207871 predicted 441
10 SASI_Hs01_00207872 predicted 785
11 SASI_Hs01_00207869 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190726 predicted 2028
2 SASI_Hs01_00190728 predicted 616
3 SASI_Hs01_00190729 predicted 998
4 SASI_Hs01_00190730 predicted 977
5 SASI_Hs01_00190731 predicted 1016
6 SASI_Hs01_00190732 predicted 2651
7 SASI_Hs01_00190733 predicted 1413
8 SASI_Hs01_00190734 predicted 1674
9 SASI_Hs01_00190735 predicted 1499
10 SASI_Hs02_00344700 predicted 852
11 SASI_Hs01_00190727 predicted 2369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038658 predicted 1172
2 SASI_Rn01_00038659 predicted 774
3 SASI_Rn01_00038660 predicted 731
4 SASI_Rn01_00038661 predicted 1938
5 SASI_Rn01_00038662 predicted 589
6 SASI_Rn01_00038663 predicted 1609
7 SASI_Rn01_00038664 predicted 673
8 SASI_Rn02_00200037 predicted 418
9 SASI_Rn01_00038665 predicted 1223
10 SASI_Rn01_00038666 predicted 1601
11 SASI_Rn01_00038657 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00130539 predicted 1210
2 SASI_Rn01_00130540 predicted 1455
3 SASI_Rn01_00130541 predicted 1063
4 SASI_Rn01_00130542 predicted 1020
5 SASI_Rn01_00130543 predicted 2232
6 SASI_Rn01_00130544 predicted 878
7 SASI_Rn01_00130545 predicted 1905
8 SASI_Rn01_00130546 predicted 961
9 SASI_Rn01_00130547 predicted 1511
10 SASI_Rn01_00130548 predicted 1882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188688 predicted 2225
2 SASI_Mm01_00188689 predicted 2095
3 SASI_Mm01_00188690 predicted 1020
4 SASI_Mm01_00188691 predicted 749
5 SASI_Mm01_00188693 predicted 2224
6 SASI_Mm01_00188694 predicted 1903
7 SASI_Mm01_00188695 predicted 1034
8 SASI_Mm01_00188696 predicted 1453
9 SASI_Mm01_00188697 predicted 616
10 SASI_Mm02_00341383 predicted 693
11 SASI_Mm01_00188692 predicted 1695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145929
VALIDATED
GGA1 MISSION shRNA Bacterial Glycerol Stock
golgi-associated, gamma adaptin ear containing, ARF binding protein 1
Mouse
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145929.1-2894s1c1
Sequence:CCGGCCAGAGTTCCATGCTCCATTACTCGAGTAATGGAGCATGGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145929.1-959s1c1
Sequence:CCGGGCTGCCAATAAGCTCATCAAACTCGAGTTTGATGAGCTTATTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145929.1-1246s1c1
Sequence:CCGGCCAGGTGATCAACCTGTACAACTCGAGTTGTACAGGTTGATCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145929.1-2194s1c1
Sequence:CCGGCCTCCGCTACAAGCTCATCTTCTCGAGAAGATGAGCTTGTAGCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145929.1-872s1c1
Sequence:CCGGCGGCCCAAGAATGTGATCTTTCTCGAGAAAGATCACATTCTTGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145929.2-2333s21c1
Sequence:CCGGACCTGTTCATCCTGTGCTTCTCTCGAGAGAAGCACAGGATGAACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-1540s21c1
Sequence:CCGGGTCATCAGATGGCACTGAATCCTCGAGGATTCAGTGCCATCTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-1498s21c1
Sequence:CCGGTTCAGGCACCAGCTCAGATAGCTCGAGCTATCTGAGCTGGTGCCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145929.2-2567s21c1
Sequence:CCGGGGGTCGTCCTCACCTGTCTTTCTCGAGAAAGACAGGTGAGGACGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-1449s21c1
Sequence:CCGGTGCTTGATGACGAGCTCATGTCTCGAGACATGAGCTCGTCATCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-873s21c1
Sequence:CCGGGGCCCAAGAATGTGATCTTTGCTCGAGCAAAGATCACATTCTTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-762s21c1
Sequence:CCGGTGCCTGAGGAGGTGAAGATTGCTCGAGCAATCTTCACCTCCTCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-1907s21c1
Sequence:CCGGATCTTGCCAGTGACCGTTTATCTCGAGATAAACGGTCACTGGCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-2201s21c1
Sequence:CCGGTACAAGCTCATCTTCACTATGCTCGAGCATAGTGAAGATGAGCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-1014s21c1
Sequence:CCGGAGATCTCCAAGCGGGTGAATGCTCGAGCATTCACCCGCTTGGAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-423s21c1
Sequence:CCGGGAATCAACAGAGCCACAAATCCTCGAGGATTTGTGGCTCTGTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-489s21c1
Sequence:CCGGAGCAGCTCAACGAAGACTTTGCTCGAGCAAAGTCTTCGTTGAGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145929
VALIDATED
GGA1 MISSION shRNA shRNA Plasmid DNA
golgi-associated, gamma adaptin ear containing, ARF binding protein 1
Mouse
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145929.1-2894s1c1
Sequence:CCGGCCAGAGTTCCATGCTCCATTACTCGAGTAATGGAGCATGGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145929.1-959s1c1
Sequence:CCGGGCTGCCAATAAGCTCATCAAACTCGAGTTTGATGAGCTTATTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145929.1-1246s1c1
Sequence:CCGGCCAGGTGATCAACCTGTACAACTCGAGTTGTACAGGTTGATCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145929.1-2194s1c1
Sequence:CCGGCCTCCGCTACAAGCTCATCTTCTCGAGAAGATGAGCTTGTAGCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145929.1-872s1c1
Sequence:CCGGCGGCCCAAGAATGTGATCTTTCTCGAGAAAGATCACATTCTTGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145929.2-2333s21c1
Sequence:CCGGACCTGTTCATCCTGTGCTTCTCTCGAGAGAAGCACAGGATGAACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-1540s21c1
Sequence:CCGGGTCATCAGATGGCACTGAATCCTCGAGGATTCAGTGCCATCTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-1498s21c1
Sequence:CCGGTTCAGGCACCAGCTCAGATAGCTCGAGCTATCTGAGCTGGTGCCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145929.2-2567s21c1
Sequence:CCGGGGGTCGTCCTCACCTGTCTTTCTCGAGAAAGACAGGTGAGGACGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-1449s21c1
Sequence:CCGGTGCTTGATGACGAGCTCATGTCTCGAGACATGAGCTCGTCATCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-873s21c1
Sequence:CCGGGGCCCAAGAATGTGATCTTTGCTCGAGCAAAGATCACATTCTTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-762s21c1
Sequence:CCGGTGCCTGAGGAGGTGAAGATTGCTCGAGCAATCTTCACCTCCTCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-1907s21c1
Sequence:CCGGATCTTGCCAGTGACCGTTTATCTCGAGATAAACGGTCACTGGCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-2201s21c1
Sequence:CCGGTACAAGCTCATCTTCACTATGCTCGAGCATAGTGAAGATGAGCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-1014s21c1
Sequence:CCGGAGATCTCCAAGCGGGTGAATGCTCGAGCATTCACCCGCTTGGAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-423s21c1
Sequence:CCGGGAATCAACAGAGCCACAAATCCTCGAGGATTTGTGGCTCTGTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-489s21c1
Sequence:CCGGAGCAGCTCAACGAAGACTTTGCTCGAGCAAAGTCTTCGTTGAGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145929
VALIDATED
GGA1 MISSION shRNA Lentiviral Transduction Particles
golgi-associated, gamma adaptin ear containing, ARF binding protein 1
Mouse
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145929.1-2894s1c1
Sequence:CCGGCCAGAGTTCCATGCTCCATTACTCGAGTAATGGAGCATGGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145929.1-959s1c1
Sequence:CCGGGCTGCCAATAAGCTCATCAAACTCGAGTTTGATGAGCTTATTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145929.1-1246s1c1
Sequence:CCGGCCAGGTGATCAACCTGTACAACTCGAGTTGTACAGGTTGATCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145929.1-2194s1c1
Sequence:CCGGCCTCCGCTACAAGCTCATCTTCTCGAGAAGATGAGCTTGTAGCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145929.1-872s1c1
Sequence:CCGGCGGCCCAAGAATGTGATCTTTCTCGAGAAAGATCACATTCTTGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145929.2-2333s21c1
Sequence:CCGGACCTGTTCATCCTGTGCTTCTCTCGAGAGAAGCACAGGATGAACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-1540s21c1
Sequence:CCGGGTCATCAGATGGCACTGAATCCTCGAGGATTCAGTGCCATCTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-1498s21c1
Sequence:CCGGTTCAGGCACCAGCTCAGATAGCTCGAGCTATCTGAGCTGGTGCCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145929.2-2567s21c1
Sequence:CCGGGGGTCGTCCTCACCTGTCTTTCTCGAGAAAGACAGGTGAGGACGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-1449s21c1
Sequence:CCGGTGCTTGATGACGAGCTCATGTCTCGAGACATGAGCTCGTCATCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-873s21c1
Sequence:CCGGGGCCCAAGAATGTGATCTTTGCTCGAGCAAAGATCACATTCTTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-762s21c1
Sequence:CCGGTGCCTGAGGAGGTGAAGATTGCTCGAGCAATCTTCACCTCCTCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-1907s21c1
Sequence:CCGGATCTTGCCAGTGACCGTTTATCTCGAGATAAACGGTCACTGGCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-2201s21c1
Sequence:CCGGTACAAGCTCATCTTCACTATGCTCGAGCATAGTGAAGATGAGCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-1014s21c1
Sequence:CCGGAGATCTCCAAGCGGGTGAATGCTCGAGCATTCACCCGCTTGGAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-423s21c1
Sequence:CCGGGAATCAACAGAGCCACAAATCCTCGAGGATTTGTGGCTCTGTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145929.2-489s21c1
Sequence:CCGGAGCAGCTCAACGAAGACTTTGCTCGAGCAAAGTCTTCGTTGAGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001560
GGA1 MISSION shRNA Bacterial Glycerol Stock
golgi-associated, gamma adaptin ear containing, ARF binding protein 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001560.1-2295s1c1
Sequence:CCGGCCTTGGAAGAACTTGGGTCATCTCGAGATGACCCAAGTTCTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001560.1-939s1c1
Sequence:CCGGGCAGCCAATAAGCTCATCAAACTCGAGTTTGATGAGCTTATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001560.1-855s1c1
Sequence:CCGGCCGAAGAATGTGATCTTTGAACTCGAGTTCAAAGATCACATTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001560.1-401s1c1
Sequence:CCGGGCGAATCAATAGAGCCACGAACTCGAGTTCGTGGCTCTATTGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001560.1-1023s1c1
Sequence:CCGGGAGGTGAACAACAATGTGAAACTCGAGTTTCACATTGTTGTTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-617s21c1
Sequence:GTACCGGAGTGGGCAAGTTCCGCTTTCTCTCGAGAGAAAGCGGAACTTGCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-853s21c1
Sequence:GTACCGGGGCCGAAGAATGTGATCTTTGCTCGAGCAAAGATCACATTCTTCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001560.1-2393s21c1
Sequence:GTACCGGCACCTGTCTCTTATGCCTTATCTCGAGATAAGGCATAAGAGACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-682s21c1
Sequence:GTACCGGGGACATCGGAGAAGGTGAAGACTCGAGTCTTCACCTTCTCCGATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-994s21c1
Sequence:GTACCGGAGATCTCGAAGAGGGTGAATGCTCGAGCATTCACCCTCTTCGAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001560.1-2160s21c1
Sequence:GTACCGGTGTAGGCCTCAAGTGACTCTTCTCGAGAAGAGTCACTTGAGGCCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-764s21c1
Sequence:GTACCGGAGAGGCCTACCAGATGCTAAACTCGAGTTTAGCATCTGGTAGGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-652s21c1
Sequence:GTACCGGAGGTCGTGTCTCCCAAGTATCCTCGAGGATACTTGGGAGACACGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-1037s21c1
Sequence:GTACCGGTGTGAAACTGCTCACGGAGATCTCGAGATCTCCGTGAGCAGTTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001560
GGA1 MISSION shRNA shRNA Plasmid DNA
golgi-associated, gamma adaptin ear containing, ARF binding protein 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001560.1-2295s1c1
Sequence:CCGGCCTTGGAAGAACTTGGGTCATCTCGAGATGACCCAAGTTCTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001560.1-939s1c1
Sequence:CCGGGCAGCCAATAAGCTCATCAAACTCGAGTTTGATGAGCTTATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001560.1-855s1c1
Sequence:CCGGCCGAAGAATGTGATCTTTGAACTCGAGTTCAAAGATCACATTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001560.1-401s1c1
Sequence:CCGGGCGAATCAATAGAGCCACGAACTCGAGTTCGTGGCTCTATTGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001560.1-1023s1c1
Sequence:CCGGGAGGTGAACAACAATGTGAAACTCGAGTTTCACATTGTTGTTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-617s21c1
Sequence:GTACCGGAGTGGGCAAGTTCCGCTTTCTCTCGAGAGAAAGCGGAACTTGCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-853s21c1
Sequence:GTACCGGGGCCGAAGAATGTGATCTTTGCTCGAGCAAAGATCACATTCTTCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001560.1-2393s21c1
Sequence:GTACCGGCACCTGTCTCTTATGCCTTATCTCGAGATAAGGCATAAGAGACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-682s21c1
Sequence:GTACCGGGGACATCGGAGAAGGTGAAGACTCGAGTCTTCACCTTCTCCGATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-994s21c1
Sequence:GTACCGGAGATCTCGAAGAGGGTGAATGCTCGAGCATTCACCCTCTTCGAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001560.1-2160s21c1
Sequence:GTACCGGTGTAGGCCTCAAGTGACTCTTCTCGAGAAGAGTCACTTGAGGCCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-764s21c1
Sequence:GTACCGGAGAGGCCTACCAGATGCTAAACTCGAGTTTAGCATCTGGTAGGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-652s21c1
Sequence:GTACCGGAGGTCGTGTCTCCCAAGTATCCTCGAGGATACTTGGGAGACACGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-1037s21c1
Sequence:GTACCGGTGTGAAACTGCTCACGGAGATCTCGAGATCTCCGTGAGCAGTTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001560
GGA1 MISSION shRNA Lentiviral Transduction Particles
golgi-associated, gamma adaptin ear containing, ARF binding protein 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001560.1-2295s1c1
Sequence:CCGGCCTTGGAAGAACTTGGGTCATCTCGAGATGACCCAAGTTCTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001560.1-939s1c1
Sequence:CCGGGCAGCCAATAAGCTCATCAAACTCGAGTTTGATGAGCTTATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001560.1-855s1c1
Sequence:CCGGCCGAAGAATGTGATCTTTGAACTCGAGTTCAAAGATCACATTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001560.1-401s1c1
Sequence:CCGGGCGAATCAATAGAGCCACGAACTCGAGTTCGTGGCTCTATTGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001560.1-1023s1c1
Sequence:CCGGGAGGTGAACAACAATGTGAAACTCGAGTTTCACATTGTTGTTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-617s21c1
Sequence:GTACCGGAGTGGGCAAGTTCCGCTTTCTCTCGAGAGAAAGCGGAACTTGCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-853s21c1
Sequence:GTACCGGGGCCGAAGAATGTGATCTTTGCTCGAGCAAAGATCACATTCTTCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001560.1-2393s21c1
Sequence:GTACCGGCACCTGTCTCTTATGCCTTATCTCGAGATAAGGCATAAGAGACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-682s21c1
Sequence:GTACCGGGGACATCGGAGAAGGTGAAGACTCGAGTCTTCACCTTCTCCGATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-994s21c1
Sequence:GTACCGGAGATCTCGAAGAGGGTGAATGCTCGAGCATTCACCCTCTTCGAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001560.1-2160s21c1
Sequence:GTACCGGTGTAGGCCTCAAGTGACTCTTCTCGAGAAGAGTCACTTGAGGCCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-764s21c1
Sequence:GTACCGGAGAGGCCTACCAGATGCTAAACTCGAGTTTAGCATCTGGTAGGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-652s21c1
Sequence:GTACCGGAGGTCGTGTCTCCCAAGTATCCTCGAGGATACTTGGGAGACACGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001560.1-1037s21c1
Sequence:GTACCGGTGTGAAACTGCTCACGGAGATCTCGAGATCTCCGTGAGCAGTTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks