EMAIL THIS PAGE TO A FRIEND

GGA2

golgi-associated, gamma adaptin ear containing, ARF binding protein 2

Synonyms: VEAR
UniProtKB ID: Q9UJY4, D3DWF0, O14564, Q9NYN2, Q9UPS2
Gene ID:
Human(23062) Summary: This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) family. This family includes ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. This family member may play a significant role in cargo molecules regulation and clathrin-coated vesicle assembly. [provided by RefSeq, Jul 2008]
Mouse(74105) golgi associated, gamma adaptin ear containing, ARF binding protein 2
Rat(293455) golgi associated, gamma adaptin ear containing, ARF binding protein 2
naked mole-rat(101718247) golgi-associated, gamma adaptin ear containing, ARF binding protein 2
domestic guinea pig(100720654) golgi-associated, gamma adaptin ear containing, ARF binding protein 2
sheep(101117133) golgi-associated, gamma adaptin ear containing, ARF binding protein 2
Domestic Rabbit(100355285) golgi-associated, gamma adaptin ear containing, ARF binding protein 2
chicken(416577) golgi-associated, gamma adaptin ear containing, ARF binding protein 2
domestic cat(101090226) golgi-associated, gamma adaptin ear containing, ARF binding protein 2
cow(517031) golgi-associated, gamma adaptin ear containing, ARF binding protein 2
Horse(100069034) golgi-associated, gamma adaptin ear containing, ARF binding protein 2
dog(608555) golgi-associated, gamma adaptin ear containing, ARF binding protein 2
135 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015044 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015044 Rosetta Predictions human pricing
XM_001072617 Rosetta Predictions rat pricing
XM_001076216 Rosetta Predictions rat pricing
XM_001076241 Rosetta Predictions rat pricing
XM_215045 Rosetta Predictions rat pricing
NM_028758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060564 predicted 303
2 SASI_Hs01_00060565 predicted 940
3 SASI_Hs01_00060566 predicted 1238
4 SASI_Hs01_00060567 predicted 1767
5 SASI_Hs01_00060568 predicted 1794
6 SASI_Hs01_00060569 predicted 558
7 SASI_Hs01_00060570 predicted 649
8 SASI_Hs01_00060572 predicted 1217
9 SASI_Hs01_00060573 predicted 1359
10 SASI_Hs02_00346883 predicted 1532
11 SASI_Hs01_00060571 predicted 1693
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339891 predicted 597
2 SASI_Rn02_00339892 predicted 681
3 SASI_Rn02_00339893 predicted 1770
4 SASI_Rn02_00339894 predicted 502
5 SASI_Rn02_00339895 predicted 1927
6 SASI_Rn02_00339896 predicted 570
7 SASI_Rn02_00339897 predicted 1238
8 SASI_Rn02_00339898 predicted 348
9 SASI_Rn02_00339899 predicted 1236
10 SASI_Rn02_00339900 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352411 predicted 1640
2 SASI_Rn02_00352412 predicted 827
3 SASI_Rn02_00352413 predicted 1275
4 SASI_Rn02_00352414 predicted 1428
5 SASI_Rn02_00352415 predicted 747
6 SASI_Rn02_00352416 predicted 1545
7 SASI_Rn02_00352417 predicted 734
8 SASI_Rn02_00352418 predicted 496
9 SASI_Rn02_00352419 predicted 1308
10 SASI_Rn02_00352420 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352523 predicted 597
2 SASI_Rn02_00352524 predicted 674
3 SASI_Rn02_00352525 predicted 1775
4 SASI_Rn02_00352526 predicted 497
5 SASI_Rn02_00352527 predicted 1930
6 SASI_Rn02_00352528 predicted 577
7 SASI_Rn02_00352529 predicted 1236
8 SASI_Rn02_00352530 predicted 341
9 SASI_Rn02_00352531 predicted 1232
10 SASI_Rn02_00352532 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375757 predicted 1638
2 SASI_Rn02_00375758 predicted 823
3 SASI_Rn02_00375759 predicted 1281
4 SASI_Rn02_00375760 predicted 1433
5 SASI_Rn02_00375761 predicted 745
6 SASI_Rn02_00375762 predicted 1545
7 SASI_Rn02_00375763 predicted 741
8 SASI_Rn02_00375764 predicted 487
9 SASI_Rn02_00375765 predicted 1304
10 SASI_Rn02_00375766 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334339 predicted 737
2 SASI_Mm02_00334340 predicted 505
3 SASI_Mm02_00334341 predicted 1485
4 SASI_Mm02_00334342 predicted 1802
5 SASI_Mm02_00334343 predicted 1244
6 SASI_Mm02_00334344 predicted 1311
7 SASI_Mm02_00334345 predicted 700
8 SASI_Mm02_00334346 predicted 1370
9 SASI_Mm02_00334347 predicted 1139
10 SASI_Mm02_00334348 predicted 352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028758
VALIDATED
GGA2 MISSION shRNA Bacterial Glycerol Stock
golgi-associated, gamma adaptin ear containing, ARF binding protein 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028758.2-2310s21c1
Sequence:GTACCGGAGTTGCTCCCAGGCTGCTATTCTCGAGAATAGCAGCCTGGGAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028758.2-996s21c1
Sequence:CCGGGCGGAGATTCTTCAAGCAAATCTCGAGATTTGCTTGAAGAATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028758.2-1826s21c1
Sequence:CCGGGCGGTATAAGCTGACTTTCAACTCGAGTTGAAAGTCAGCTTATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028758.2-1206s21c1
Sequence:CCGGGCCTTAGGAATCAACGATGTTCTCGAGAACATCGTTGATTCCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028758.2-695s21c1
Sequence:CCGGGCTTCTGACAAGACTTCTCAACTCGAGTTGAGAAGTCTTGTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028758.2-2160s21c1
Sequence:GTACCGGTCATCTCTGCTGCACTCATACCTCGAGGTATGAGTGCAGCAGAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028758.1-3697s1c1
Sequence:CCGGGCCATCAAATTTATGGCTTTACTCGAGTAAAGCCATAAATTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028758.1-1795s1c1
Sequence:CCGGGCGGTATAAGCTGACTTTCAACTCGAGTTGAAAGTCAGCTTATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028758.1-664s1c1
Sequence:CCGGGCTTCTGACAAGACTTCTCAACTCGAGTTGAGAAGTCTTGTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028758.1-1175s1c1
Sequence:CCGGGCCTTAGGAATCAACGATGTTCTCGAGAACATCGTTGATTCCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028758.1-965s1c1
Sequence:CCGGGCGGAGATTCTTCAAGCAAATCTCGAGATTTGCTTGAAGAATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028758
VALIDATED
GGA2 MISSION shRNA shRNA Plasmid DNA
golgi-associated, gamma adaptin ear containing, ARF binding protein 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028758.2-2310s21c1
Sequence:GTACCGGAGTTGCTCCCAGGCTGCTATTCTCGAGAATAGCAGCCTGGGAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028758.2-996s21c1
Sequence:CCGGGCGGAGATTCTTCAAGCAAATCTCGAGATTTGCTTGAAGAATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028758.2-1826s21c1
Sequence:CCGGGCGGTATAAGCTGACTTTCAACTCGAGTTGAAAGTCAGCTTATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028758.2-1206s21c1
Sequence:CCGGGCCTTAGGAATCAACGATGTTCTCGAGAACATCGTTGATTCCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028758.2-695s21c1
Sequence:CCGGGCTTCTGACAAGACTTCTCAACTCGAGTTGAGAAGTCTTGTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028758.2-2160s21c1
Sequence:GTACCGGTCATCTCTGCTGCACTCATACCTCGAGGTATGAGTGCAGCAGAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028758.1-3697s1c1
Sequence:CCGGGCCATCAAATTTATGGCTTTACTCGAGTAAAGCCATAAATTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028758.1-1795s1c1
Sequence:CCGGGCGGTATAAGCTGACTTTCAACTCGAGTTGAAAGTCAGCTTATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028758.1-664s1c1
Sequence:CCGGGCTTCTGACAAGACTTCTCAACTCGAGTTGAGAAGTCTTGTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028758.1-1175s1c1
Sequence:CCGGGCCTTAGGAATCAACGATGTTCTCGAGAACATCGTTGATTCCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028758.1-965s1c1
Sequence:CCGGGCGGAGATTCTTCAAGCAAATCTCGAGATTTGCTTGAAGAATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028758
VALIDATED
GGA2 MISSION shRNA Lentiviral Transduction Particles
golgi-associated, gamma adaptin ear containing, ARF binding protein 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028758.2-2310s21c1
Sequence:GTACCGGAGTTGCTCCCAGGCTGCTATTCTCGAGAATAGCAGCCTGGGAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028758.2-996s21c1
Sequence:CCGGGCGGAGATTCTTCAAGCAAATCTCGAGATTTGCTTGAAGAATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028758.2-1826s21c1
Sequence:CCGGGCGGTATAAGCTGACTTTCAACTCGAGTTGAAAGTCAGCTTATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028758.2-1206s21c1
Sequence:CCGGGCCTTAGGAATCAACGATGTTCTCGAGAACATCGTTGATTCCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028758.2-695s21c1
Sequence:CCGGGCTTCTGACAAGACTTCTCAACTCGAGTTGAGAAGTCTTGTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028758.2-2160s21c1
Sequence:GTACCGGTCATCTCTGCTGCACTCATACCTCGAGGTATGAGTGCAGCAGAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028758.1-3697s1c1
Sequence:CCGGGCCATCAAATTTATGGCTTTACTCGAGTAAAGCCATAAATTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028758.1-1795s1c1
Sequence:CCGGGCGGTATAAGCTGACTTTCAACTCGAGTTGAAAGTCAGCTTATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028758.1-664s1c1
Sequence:CCGGGCTTCTGACAAGACTTCTCAACTCGAGTTGAGAAGTCTTGTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028758.1-1175s1c1
Sequence:CCGGGCCTTAGGAATCAACGATGTTCTCGAGAACATCGTTGATTCCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028758.1-965s1c1
Sequence:CCGGGCGGAGATTCTTCAAGCAAATCTCGAGATTTGCTTGAAGAATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015044
VALIDATED
GGA2 MISSION shRNA Bacterial Glycerol Stock
golgi-associated, gamma adaptin ear containing, ARF binding protein 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015044.3-1358s21c1
Sequence:CCGGCCGTGCCCTCTGAATTATGTTCTCGAGAACATAATTCAGAGGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015044.3-655s21c1
Sequence:CCGGGCTTCTGACAAGGCTTCTAAACTCGAGTTTAGAAGCCTTGTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015044.3-1230s21c1
Sequence:CCGGGCATGGTTTCTGGTCAGAATTCTCGAGAATTCTGACCAGAAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015044.3-2354s21c1
Sequence:CCGGGCTGTTCTCAGGGACCTTAAACTCGAGTTTAAGGTCCCTGAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015044.3-944s21c1
Sequence:CCGGGATGATGCACTCGCGGAAATTCTCGAGAATTTCCGCGAGTGCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015044.3-393s21c1
Sequence:GTACCGGTCCTGAACGAACTGATCAAAGCTCGAGCTTTGATCAGTTCGTTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015044.3-1924s21c1
Sequence:GTACCGGCACAAGATGGACCCTTCATTTCTCGAGAAATGAAGGGTCCATCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015044.2-1826s1c1
Sequence:CCGGCTTACGGTACAAGCTGACATTCTCGAGAATGTCAGCTTGTACCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015044.2-1365s1c1
Sequence:CCGGCCGTGCCCTCTGAATTATGTTCTCGAGAACATAATTCAGAGGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015044.2-1237s1c1
Sequence:CCGGGCATGGTTTCTGGTCAGAATTCTCGAGAATTCTGACCAGAAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015044.2-534s1c1
Sequence:CCGGGCTTATCAGATGCTGAAGAAACTCGAGTTTCTTCAGCATCTGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015044.2-662s1c1
Sequence:CCGGGCTTCTGACAAGGCTTCTAAACTCGAGTTTAGAAGCCTTGTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015044
VALIDATED
GGA2 MISSION shRNA shRNA Plasmid DNA
golgi-associated, gamma adaptin ear containing, ARF binding protein 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015044.3-1358s21c1
Sequence:CCGGCCGTGCCCTCTGAATTATGTTCTCGAGAACATAATTCAGAGGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015044.3-655s21c1
Sequence:CCGGGCTTCTGACAAGGCTTCTAAACTCGAGTTTAGAAGCCTTGTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015044.3-1230s21c1
Sequence:CCGGGCATGGTTTCTGGTCAGAATTCTCGAGAATTCTGACCAGAAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015044.3-2354s21c1
Sequence:CCGGGCTGTTCTCAGGGACCTTAAACTCGAGTTTAAGGTCCCTGAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015044.3-944s21c1
Sequence:CCGGGATGATGCACTCGCGGAAATTCTCGAGAATTTCCGCGAGTGCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015044.3-393s21c1
Sequence:GTACCGGTCCTGAACGAACTGATCAAAGCTCGAGCTTTGATCAGTTCGTTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015044.3-1924s21c1
Sequence:GTACCGGCACAAGATGGACCCTTCATTTCTCGAGAAATGAAGGGTCCATCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015044.2-1826s1c1
Sequence:CCGGCTTACGGTACAAGCTGACATTCTCGAGAATGTCAGCTTGTACCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015044.2-1365s1c1
Sequence:CCGGCCGTGCCCTCTGAATTATGTTCTCGAGAACATAATTCAGAGGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015044.2-1237s1c1
Sequence:CCGGGCATGGTTTCTGGTCAGAATTCTCGAGAATTCTGACCAGAAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015044.2-534s1c1
Sequence:CCGGGCTTATCAGATGCTGAAGAAACTCGAGTTTCTTCAGCATCTGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015044.2-662s1c1
Sequence:CCGGGCTTCTGACAAGGCTTCTAAACTCGAGTTTAGAAGCCTTGTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015044
VALIDATED
GGA2 MISSION shRNA Lentiviral Transduction Particles
golgi-associated, gamma adaptin ear containing, ARF binding protein 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015044.3-1358s21c1
Sequence:CCGGCCGTGCCCTCTGAATTATGTTCTCGAGAACATAATTCAGAGGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015044.3-655s21c1
Sequence:CCGGGCTTCTGACAAGGCTTCTAAACTCGAGTTTAGAAGCCTTGTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015044.3-1230s21c1
Sequence:CCGGGCATGGTTTCTGGTCAGAATTCTCGAGAATTCTGACCAGAAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015044.3-2354s21c1
Sequence:CCGGGCTGTTCTCAGGGACCTTAAACTCGAGTTTAAGGTCCCTGAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015044.3-944s21c1
Sequence:CCGGGATGATGCACTCGCGGAAATTCTCGAGAATTTCCGCGAGTGCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015044.3-393s21c1
Sequence:GTACCGGTCCTGAACGAACTGATCAAAGCTCGAGCTTTGATCAGTTCGTTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015044.3-1924s21c1
Sequence:GTACCGGCACAAGATGGACCCTTCATTTCTCGAGAAATGAAGGGTCCATCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015044.2-1826s1c1
Sequence:CCGGCTTACGGTACAAGCTGACATTCTCGAGAATGTCAGCTTGTACCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015044.2-1365s1c1
Sequence:CCGGCCGTGCCCTCTGAATTATGTTCTCGAGAACATAATTCAGAGGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015044.2-1237s1c1
Sequence:CCGGGCATGGTTTCTGGTCAGAATTCTCGAGAATTCTGACCAGAAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015044.2-534s1c1
Sequence:CCGGGCTTATCAGATGCTGAAGAAACTCGAGTTTCTTCAGCATCTGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015044.2-662s1c1
Sequence:CCGGGCTTCTGACAAGGCTTCTAAACTCGAGTTTAGAAGCCTTGTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks