EMAIL THIS PAGE TO A FRIEND

GGA3

golgi-associated, gamma adaptin ear containing, ARF binding protein 3

61 Gene Product Result for
Gene ID:
Human(23163) Summary: This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) family. This family includes ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. Multiple alternatively spliced transcript variants have been identified in this gene. [provided by RefSeq, Feb 2010]
Mouse(260302) golgi associated, gamma adaptin ear containing, ARF binding protein 3
Rat(360658) golgi associated, gamma adaptin ear containing, ARF binding protein 3
Zebrafish(492643) golgi associated, gamma adaptin ear containing, ARF binding protein 3
cow(510539) golgi-associated, gamma adaptin ear containing, ARF binding protein 3
Horse(100051989) golgi-associated, gamma adaptin ear containing, ARF binding protein 3
domestic cat(101098591) golgi-associated, gamma adaptin ear containing, ARF binding protein 3
chicken(422121) golgi-associated, gamma adaptin ear containing, ARF binding protein 3
dog(483310) golgi-associated, gamma adaptin ear containing, ARF binding protein 3
sheep(101110428) golgi-associated, gamma adaptin ear containing, ARF binding protein 3
Domestic Rabbit(100343436) golgi-associated, gamma adaptin ear containing, ARF binding protein 3
domestic guinea pig(100714056) golgi-associated, gamma adaptin ear containing, ARF binding protein 3
naked mole-rat(101713542) golgi-associated, gamma adaptin ear containing, ARF binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014001 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014001 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014001 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173048 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173048 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173048 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067601 MISSION® esiRNA esiRNA human GGA3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014001 Rosetta Predictions human pricing
NM_138619 Rosetta Predictions human pricing
NM_001108304 Rosetta Predictions rat pricing
NM_173048 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344969 predicted 766
2 SASI_Hs01_00036636 predicted 1696
3 SASI_Hs01_00036637 predicted 1885
4 SASI_Hs01_00036638 predicted 753
5 SASI_Hs01_00036639 predicted 590
6 SASI_Hs01_00036640 predicted 675
7 SASI_Hs01_00036641 predicted 1130
8 SASI_Hs02_00344970 predicted 1941
9 SASI_Hs01_00036642 predicted 580
10 SASI_Hs01_00036643 predicted 1460
11 SASI_Hs01_00036644 predicted 887
12 SASI_Hs01_00036645 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363751 predicted 869
2 SASI_Hs01_00235566 predicted 1793
3 SASI_Hs01_00235567 predicted 1982
4 SASI_Hs01_00235568 predicted 848
5 SASI_Hs01_00235569 predicted 688
6 SASI_Hs01_00235570 predicted 772
7 SASI_Hs01_00235571 predicted 1223
8 SASI_Hs02_00363752 predicted 2033
9 SASI_Hs01_00235572 predicted 675
10 SASI_Hs01_00235573 predicted 1555
11 SASI_Hs01_00235574 predicted 980
12 SASI_Hs01_00235575 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237339 predicted 1818
2 SASI_Rn02_00237340 predicted 1153
3 SASI_Rn02_00237341 predicted 1433
4 SASI_Rn02_00237342 predicted 1895
5 SASI_Rn02_00237343 predicted 2386
6 SASI_Rn02_00237344 predicted 2200
7 SASI_Rn02_00237345 predicted 2618
8 SASI_Rn02_00237346 predicted 1996
9 SASI_Rn02_00237347 predicted 1996
10 SASI_Rn02_00237348 predicted 2509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153007 predicted 617
2 SASI_Mm01_00153009 predicted 1294
3 SASI_Mm01_00153010 predicted 1590
4 SASI_Mm01_00153011 predicted 978
5 SASI_Mm02_00345108 predicted 248
6 SASI_Mm01_00153012 predicted 1285
7 SASI_Mm01_00153013 predicted 1009
8 SASI_Mm01_00153014 predicted 1935
9 SASI_Mm01_00153015 predicted 2276
10 SASI_Mm01_00153016 predicted 1368
11 SASI_Mm01_00153008 predicted 2189
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014001
VALIDATED
GGA3 MISSION shRNA Bacterial Glycerol Stock
golgi-associated, gamma adaptin ear containing, ARF binding protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014001.2-772s1c1
Sequence:CCGGCGGGTCATCAACTCTTACAAACTCGAGTTTGTAAGAGTTGATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014001.2-555s1c1
Sequence:CCGGGCACACGTTAGAGGAAGTTAACTCGAGTTAACTTCCTCTAACGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014001.2-1854s1c1
Sequence:CCGGGCCCAAGTCAATGAAAGTGAACTCGAGTTCACTTTCATTGACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014001.2-286s1c1
Sequence:CCGGCCAGAAGAAGCAAAGATCAAACTCGAGTTTGATCTTTGCTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014001.2-43s1c1
Sequence:CCGGTGGCTCAATAAAGCCACCAATCTCGAGATTGGTGGCTTTATTGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_014001.2-3426s21c1
Sequence:CCGGACTATGGGAAGAGGTCATATCCTCGAGGATATGACCTCTTCCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014001.2-1702s21c1
Sequence:CCGGCCTGTGACAGCCTACGATAAACTCGAGTTTATCGTAGGCTGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_014001.2-1974s21c1
Sequence:CCGGGAAGGTGCGGCTTCGGTATAACTCGAGTTATACCGAAGCCGCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014001.2-818s21c1
Sequence:CCGGATGGCGAGGTGGCTACCTTAACTCGAGTTAAGGTAGCCACCTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014001.2-676s21c1
Sequence:CCGGGAGAACAAGAGGCGGACTTTACTCGAGTAAAGTCCGCCTCTTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014001
VALIDATED
GGA3 MISSION shRNA shRNA Plasmid DNA
golgi-associated, gamma adaptin ear containing, ARF binding protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014001.2-772s1c1
Sequence:CCGGCGGGTCATCAACTCTTACAAACTCGAGTTTGTAAGAGTTGATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014001.2-555s1c1
Sequence:CCGGGCACACGTTAGAGGAAGTTAACTCGAGTTAACTTCCTCTAACGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014001.2-1854s1c1
Sequence:CCGGGCCCAAGTCAATGAAAGTGAACTCGAGTTCACTTTCATTGACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014001.2-286s1c1
Sequence:CCGGCCAGAAGAAGCAAAGATCAAACTCGAGTTTGATCTTTGCTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014001.2-43s1c1
Sequence:CCGGTGGCTCAATAAAGCCACCAATCTCGAGATTGGTGGCTTTATTGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_014001.2-3426s21c1
Sequence:CCGGACTATGGGAAGAGGTCATATCCTCGAGGATATGACCTCTTCCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014001.2-1702s21c1
Sequence:CCGGCCTGTGACAGCCTACGATAAACTCGAGTTTATCGTAGGCTGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_014001.2-1974s21c1
Sequence:CCGGGAAGGTGCGGCTTCGGTATAACTCGAGTTATACCGAAGCCGCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014001.2-818s21c1
Sequence:CCGGATGGCGAGGTGGCTACCTTAACTCGAGTTAAGGTAGCCACCTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014001.2-676s21c1
Sequence:CCGGGAGAACAAGAGGCGGACTTTACTCGAGTAAAGTCCGCCTCTTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014001
VALIDATED
GGA3 MISSION shRNA Lentiviral Transduction Particles
golgi-associated, gamma adaptin ear containing, ARF binding protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014001.2-772s1c1
Sequence:CCGGCGGGTCATCAACTCTTACAAACTCGAGTTTGTAAGAGTTGATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014001.2-555s1c1
Sequence:CCGGGCACACGTTAGAGGAAGTTAACTCGAGTTAACTTCCTCTAACGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014001.2-1854s1c1
Sequence:CCGGGCCCAAGTCAATGAAAGTGAACTCGAGTTCACTTTCATTGACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014001.2-286s1c1
Sequence:CCGGCCAGAAGAAGCAAAGATCAAACTCGAGTTTGATCTTTGCTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014001.2-43s1c1
Sequence:CCGGTGGCTCAATAAAGCCACCAATCTCGAGATTGGTGGCTTTATTGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_014001.2-3426s21c1
Sequence:CCGGACTATGGGAAGAGGTCATATCCTCGAGGATATGACCTCTTCCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014001.2-1702s21c1
Sequence:CCGGCCTGTGACAGCCTACGATAAACTCGAGTTTATCGTAGGCTGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_014001.2-1974s21c1
Sequence:CCGGGAAGGTGCGGCTTCGGTATAACTCGAGTTATACCGAAGCCGCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014001.2-818s21c1
Sequence:CCGGATGGCGAGGTGGCTACCTTAACTCGAGTTAAGGTAGCCACCTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014001.2-676s21c1
Sequence:CCGGGAGAACAAGAGGCGGACTTTACTCGAGTAAAGTCCGCCTCTTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173048
GGA3 MISSION shRNA Bacterial Glycerol Stock
golgi-associated, gamma adaptin ear containing, ARF binding protein 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115306    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173048.1-2530s1c1
Sequence:CCGGCCCTGTAAGAACTGCATCTTTCTCGAGAAAGATGCAGTTCTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173048.1-396s1c1
Sequence:CCGGGCCGGAAGAAGCAAAGATCAACTCGAGTTGATCTTTGCTTCTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173048.1-124s1c1
Sequence:CCGGCAGATCAACAAAGAGCTTGAACTCGAGTTCAAGCTCTTTGTTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173048.1-2079s1c1
Sequence:CCGGGCTTCGATATAAACTGACCTTCTCGAGAAGGTCAGTTTATATCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173048.1-717s1c1
Sequence:CCGGGCTTCACTACAGCCAAGAGTACTCGAGTACTCTTGGCTGTAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173048.2-809s21c1
Sequence:CCGGATAAGAGGCGGACGCTGTTTACTCGAGTAAACAGCGTCCGCCTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173048.2-929s21c1
Sequence:CCGGTTGAAGGGCAGATCGTCAATGCTCGAGCATTGACGATCTGCCCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173048.2-2467s21c1
Sequence:CCGGTCTGGGCCCAGAGTAGGATTTCTCGAGAAATCCTACTCTGGGCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173048.2-2271s21c1
Sequence:CCGGACACCCTGAACAGCGTTTATACTCGAGTATAAACGCTGTTCAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173048
GGA3 MISSION shRNA shRNA Plasmid DNA
golgi-associated, gamma adaptin ear containing, ARF binding protein 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115306    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173048.1-2530s1c1
Sequence:CCGGCCCTGTAAGAACTGCATCTTTCTCGAGAAAGATGCAGTTCTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173048.1-396s1c1
Sequence:CCGGGCCGGAAGAAGCAAAGATCAACTCGAGTTGATCTTTGCTTCTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173048.1-124s1c1
Sequence:CCGGCAGATCAACAAAGAGCTTGAACTCGAGTTCAAGCTCTTTGTTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173048.1-2079s1c1
Sequence:CCGGGCTTCGATATAAACTGACCTTCTCGAGAAGGTCAGTTTATATCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173048.1-717s1c1
Sequence:CCGGGCTTCACTACAGCCAAGAGTACTCGAGTACTCTTGGCTGTAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173048.2-809s21c1
Sequence:CCGGATAAGAGGCGGACGCTGTTTACTCGAGTAAACAGCGTCCGCCTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173048.2-929s21c1
Sequence:CCGGTTGAAGGGCAGATCGTCAATGCTCGAGCATTGACGATCTGCCCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173048.2-2467s21c1
Sequence:CCGGTCTGGGCCCAGAGTAGGATTTCTCGAGAAATCCTACTCTGGGCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173048.2-2271s21c1
Sequence:CCGGACACCCTGAACAGCGTTTATACTCGAGTATAAACGCTGTTCAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173048
GGA3 MISSION shRNA Lentiviral Transduction Particles
golgi-associated, gamma adaptin ear containing, ARF binding protein 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115306    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173048.1-2530s1c1
Sequence:CCGGCCCTGTAAGAACTGCATCTTTCTCGAGAAAGATGCAGTTCTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173048.1-396s1c1
Sequence:CCGGGCCGGAAGAAGCAAAGATCAACTCGAGTTGATCTTTGCTTCTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173048.1-124s1c1
Sequence:CCGGCAGATCAACAAAGAGCTTGAACTCGAGTTCAAGCTCTTTGTTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173048.1-2079s1c1
Sequence:CCGGGCTTCGATATAAACTGACCTTCTCGAGAAGGTCAGTTTATATCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173048.1-717s1c1
Sequence:CCGGGCTTCACTACAGCCAAGAGTACTCGAGTACTCTTGGCTGTAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173048.2-809s21c1
Sequence:CCGGATAAGAGGCGGACGCTGTTTACTCGAGTAAACAGCGTCCGCCTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173048.2-929s21c1
Sequence:CCGGTTGAAGGGCAGATCGTCAATGCTCGAGCATTGACGATCTGCCCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173048.2-2467s21c1
Sequence:CCGGTCTGGGCCCAGAGTAGGATTTCTCGAGAAATCCTACTCTGGGCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173048.2-2271s21c1
Sequence:CCGGACACCCTGAACAGCGTTTATACTCGAGTATAAACGCTGTTCAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks