EMAIL THIS PAGE TO A FRIEND

GGACT

gamma-glutamylamine cyclotransferase

63 Gene Product Result for
Synonyms: A2LD1
UniProtKB ID: Q9BVM4, B3KTN1, Q9BT41
Gene ID:
Human(87769) Summary: The protein encoded by this gene aids in the proteolytic degradation of crosslinked fibrin by breaking down isodipeptide L-gamma-glutamyl-L-epsilon-lysine, a byproduct of fibrin degradation. The reaction catalyzed by the encoded gamma-glutamylaminecyclotransferase produces 5-oxo-L-proline and a free alkylamine. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Aug 2010]
Mouse(223267) gamma-glutamylamine cyclotransferase
Rat(290500) gamma-glutamylamine cyclotransferase
naked mole-rat(101706691) gamma-glutamylamine cyclotransferase
domestic guinea pig(100722666) gamma-glutamylamine cyclotransferase
dog(485534) gamma-glutamylamine cyclotransferase
domestic cat(101084676) gamma-glutamylamine cyclotransferase
cow(512596) gamma-glutamylamine cyclotransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145466 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145466 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145466 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033110 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033110 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033110 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015401 MISSION® esiRNA esiRNA targeting human A2LD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714498 Rosetta Predictions human pricing
XM_001714769 Rosetta Predictions human pricing
XM_001715756 Rosetta Predictions human pricing
NM_001025634 Rosetta Predictions rat pricing
NM_145466 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00397525 predicted 1389
2 SASI_Hs02_00397526 predicted 1197
3 SASI_Hs02_00397527 predicted 1324
4 SASI_Hs02_00397528 predicted 1211
5 SASI_Hs02_00397529 predicted 1267
6 SASI_Hs02_00397530 predicted 1161
7 SASI_Hs02_00397531 predicted 1382
8 SASI_Hs02_00397532 predicted 1433
9 SASI_Hs02_00397533 predicted 1332
10 SASI_Hs02_00397534 predicted 1335
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00399335 predicted 590
2 SASI_Hs02_00399336 predicted 1549
3 SASI_Hs02_00399337 predicted 1196
4 SASI_Hs02_00399338 predicted 1331
5 SASI_Hs02_00399339 predicted 559
6 SASI_Hs02_00399340 predicted 1213
7 SASI_Hs02_00399341 predicted 1566
8 SASI_Hs02_00399342 predicted 1560
9 SASI_Hs02_00399343 predicted 1274
10 SASI_Hs02_00399344 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00405907 predicted 583
2 SASI_Hs02_00405908 predicted 1545
3 SASI_Hs02_00405909 predicted 1194
4 SASI_Hs02_00405910 predicted 1329
5 SASI_Hs02_00405911 predicted 560
6 SASI_Hs02_00405912 predicted 1213
7 SASI_Hs02_00405913 predicted 1570
8 SASI_Hs02_00405914 predicted 1563
9 SASI_Hs02_00405915 predicted 1273
10 SASI_Hs02_00405916 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025634 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036823 predicted 387
2 SASI_Rn01_00036824 predicted 386
3 SASI_Rn02_00203203 predicted 562
4 SASI_Rn01_00036826 predicted 313
5 SASI_Rn01_00036827 predicted 262
6 SASI_Rn01_00036828 predicted 529
7 SASI_Rn01_00036829 predicted 536
8 SASI_Rn01_00036830 predicted 321
9 SASI_Rn01_00036831 predicted 596
10 SASI_Rn01_00036832 predicted 408
11 SASI_Rn01_00036825 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068793 predicted 388
2 SASI_Mm01_00068794 predicted 282
3 SASI_Mm01_00068795 predicted 507
4 SASI_Mm01_00068796 predicted 463
5 SASI_Mm01_00068798 predicted 327
6 SASI_Mm02_00340863 predicted 231
7 SASI_Mm01_00068799 predicted 569
8 SASI_Mm01_00068800 predicted 204
9 SASI_Mm01_00068801 predicted 493
10 SASI_Mm01_00068802 predicted 427
11 SASI_Mm01_00068797 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145466
VALIDATED
GGACT MISSION shRNA Bacterial Glycerol Stock
gamma-glutamylamine cyclotransferase
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145466.2-359s21c1
Sequence:CCGGGTTGCGTTTCCTGGATGACTTCTCGAGAAGTCATCCAGGAAACGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145466.1-491s1c1
Sequence:CCGGCTACCATGAAAGCTATGATTCCTCGAGGAATCATAGCTTTCATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145466.1-480s1c1
Sequence:CCGGCTGTTTCTTCCCTACCATGAACTCGAGTTCATGGTAGGGAAGAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145466.2-266s21c1
Sequence:CCGGGATTGCAGGCGAGCACAACATCTCGAGATGTTGTGCTCGCCTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145466.2-348s21c1
Sequence:CCGGGACGAGCAGATGTTGCGTTTCCTCGAGGAAACGCAACATCTGCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145466.2-249s21c1
Sequence:CCGGGAGTCCTTCCCACTGGTGATTCTCGAGAATCACCAGTGGGAAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145466.2-624s21c1
Sequence:CCGGCCAGATAGCTTCCTGGCATAACTCGAGTTATGCCAGGAAGCTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145466.1-146s1c1
Sequence:CCGGCCAACCCAACCACAAAGTCATCTCGAGATGACTTTGTGGTTGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145466.1-876s1c1
Sequence:CCGGGCATCTCAGAAGTCGAATCTACTCGAGTAGATTCGACTTCTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145466.1-620s1c1
Sequence:CCGGGCTTTCCAAGTTCAACTCTAACTCGAGTTAGAGTTGAACTTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145466.1-168s1c1
Sequence:CCGGCTGGACCATTCACATGGCTTACTCGAGTAAGCCATGTGAATGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145466.1-251s1c1
Sequence:CCGGCAACATACCTTGGCTGCTGTACTCGAGTACAGCAGCCAAGGTATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145466.1-447s1c1
Sequence:CCGGGTGTACACTACAGCCACCTATCTCGAGATAGGTGGCTGTAGTGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145466
VALIDATED
GGACT MISSION shRNA shRNA Plasmid DNA
gamma-glutamylamine cyclotransferase
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145466.2-359s21c1
Sequence:CCGGGTTGCGTTTCCTGGATGACTTCTCGAGAAGTCATCCAGGAAACGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145466.1-491s1c1
Sequence:CCGGCTACCATGAAAGCTATGATTCCTCGAGGAATCATAGCTTTCATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145466.1-480s1c1
Sequence:CCGGCTGTTTCTTCCCTACCATGAACTCGAGTTCATGGTAGGGAAGAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145466.2-266s21c1
Sequence:CCGGGATTGCAGGCGAGCACAACATCTCGAGATGTTGTGCTCGCCTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145466.2-348s21c1
Sequence:CCGGGACGAGCAGATGTTGCGTTTCCTCGAGGAAACGCAACATCTGCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145466.2-249s21c1
Sequence:CCGGGAGTCCTTCCCACTGGTGATTCTCGAGAATCACCAGTGGGAAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145466.2-624s21c1
Sequence:CCGGCCAGATAGCTTCCTGGCATAACTCGAGTTATGCCAGGAAGCTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145466.1-146s1c1
Sequence:CCGGCCAACCCAACCACAAAGTCATCTCGAGATGACTTTGTGGTTGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145466.1-876s1c1
Sequence:CCGGGCATCTCAGAAGTCGAATCTACTCGAGTAGATTCGACTTCTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145466.1-620s1c1
Sequence:CCGGGCTTTCCAAGTTCAACTCTAACTCGAGTTAGAGTTGAACTTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145466.1-168s1c1
Sequence:CCGGCTGGACCATTCACATGGCTTACTCGAGTAAGCCATGTGAATGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145466.1-251s1c1
Sequence:CCGGCAACATACCTTGGCTGCTGTACTCGAGTACAGCAGCCAAGGTATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145466.1-447s1c1
Sequence:CCGGGTGTACACTACAGCCACCTATCTCGAGATAGGTGGCTGTAGTGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145466
VALIDATED
GGACT MISSION shRNA Lentiviral Transduction Particles
gamma-glutamylamine cyclotransferase
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145466.2-359s21c1
Sequence:CCGGGTTGCGTTTCCTGGATGACTTCTCGAGAAGTCATCCAGGAAACGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145466.1-491s1c1
Sequence:CCGGCTACCATGAAAGCTATGATTCCTCGAGGAATCATAGCTTTCATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145466.1-480s1c1
Sequence:CCGGCTGTTTCTTCCCTACCATGAACTCGAGTTCATGGTAGGGAAGAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145466.2-266s21c1
Sequence:CCGGGATTGCAGGCGAGCACAACATCTCGAGATGTTGTGCTCGCCTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145466.2-348s21c1
Sequence:CCGGGACGAGCAGATGTTGCGTTTCCTCGAGGAAACGCAACATCTGCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145466.2-249s21c1
Sequence:CCGGGAGTCCTTCCCACTGGTGATTCTCGAGAATCACCAGTGGGAAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145466.2-624s21c1
Sequence:CCGGCCAGATAGCTTCCTGGCATAACTCGAGTTATGCCAGGAAGCTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145466.1-146s1c1
Sequence:CCGGCCAACCCAACCACAAAGTCATCTCGAGATGACTTTGTGGTTGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145466.1-876s1c1
Sequence:CCGGGCATCTCAGAAGTCGAATCTACTCGAGTAGATTCGACTTCTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145466.1-620s1c1
Sequence:CCGGGCTTTCCAAGTTCAACTCTAACTCGAGTTAGAGTTGAACTTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145466.1-168s1c1
Sequence:CCGGCTGGACCATTCACATGGCTTACTCGAGTAAGCCATGTGAATGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145466.1-251s1c1
Sequence:CCGGCAACATACCTTGGCTGCTGTACTCGAGTACAGCAGCCAAGGTATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145466.1-447s1c1
Sequence:CCGGGTGTACACTACAGCCACCTATCTCGAGATAGGTGGCTGTAGTGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033110
GGACT MISSION shRNA Bacterial Glycerol Stock
gamma-glutamylamine cyclotransferase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033110.1-1002s21c1
Sequence:CCGGCTTGGTGTTGCCGCTAGATTTCTCGAGAAATCTAGCGGCAACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033110.1-413s21c1
Sequence:CCGGGCTGCGCTTTCTGGATGACTTCTCGAGAAGTCATCCAGAAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033110.1-421s21c1
Sequence:CCGGTTCTGGATGACTTCGAGAGTTCTCGAGAACTCTCGAAGTCATCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033110.1-529s21c1
Sequence:CCGGCGGTGCAGTGCTTCGTGTACACTCGAGTGTACACGAAGCACTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033110.1-587s21c1
Sequence:CCGGGCACCATGACAGCTACGACTCCTCGAGGAGTCGTAGCTGTCATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033110
GGACT MISSION shRNA shRNA Plasmid DNA
gamma-glutamylamine cyclotransferase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033110.1-1002s21c1
Sequence:CCGGCTTGGTGTTGCCGCTAGATTTCTCGAGAAATCTAGCGGCAACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033110.1-413s21c1
Sequence:CCGGGCTGCGCTTTCTGGATGACTTCTCGAGAAGTCATCCAGAAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033110.1-421s21c1
Sequence:CCGGTTCTGGATGACTTCGAGAGTTCTCGAGAACTCTCGAAGTCATCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033110.1-529s21c1
Sequence:CCGGCGGTGCAGTGCTTCGTGTACACTCGAGTGTACACGAAGCACTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033110.1-587s21c1
Sequence:CCGGGCACCATGACAGCTACGACTCCTCGAGGAGTCGTAGCTGTCATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033110
GGACT MISSION shRNA Lentiviral Transduction Particles
gamma-glutamylamine cyclotransferase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033110.1-1002s21c1
Sequence:CCGGCTTGGTGTTGCCGCTAGATTTCTCGAGAAATCTAGCGGCAACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033110.1-413s21c1
Sequence:CCGGGCTGCGCTTTCTGGATGACTTCTCGAGAAGTCATCCAGAAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033110.1-421s21c1
Sequence:CCGGTTCTGGATGACTTCGAGAGTTCTCGAGAACTCTCGAAGTCATCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033110.1-529s21c1
Sequence:CCGGCGGTGCAGTGCTTCGTGTACACTCGAGTGTACACGAAGCACTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033110.1-587s21c1
Sequence:CCGGGCACCATGACAGCTACGACTCCTCGAGGAGTCGTAGCTGTCATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks