EMAIL THIS PAGE TO A FRIEND

GGCT

gamma-glutamylcyclotransferase

Synonyms: C7orf24 CRF21 GCTG GGC
UniProtKB ID: O75223, B2RDN0, B8ZZN4, B8ZZR8, Q9BS37
Gene ID:
Human(79017) Summary: The protein encoded by this gene catalyzes the formation of 5-oxoproline from gamma-glutamyl dipeptides, the penultimate step in glutathione catabolism, and may play a critical role in glutathione homeostasis. The encoded protein may also play a role in cell proliferation, and the expression of this gene is a potential marker for cancer. Pseudogenes of this gene are located on the long arm of chromosome 5 and the short arm of chromosomes 2 and 20. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Mouse(110175) gamma-glutamyl cyclotransferase
Rat(362368) gamma-glutamyl cyclotransferase
chicken(420676) gamma-glutamylcyclotransferase
dog(611603) gamma-glutamylcyclotransferase
domestic cat(101087219) gamma-glutamylcyclotransferase
cow(533374) gamma-glutamylcyclotransferase
sheep(101102474) gamma-glutamylcyclotransferase
domestic guinea pig(100723170) gamma-glutamylcyclotransferase
naked mole-rat(101723887) gamma-glutamylcyclotransferase
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024051 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024051 Rosetta Predictions human pricing
NM_001108629 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164226 predicted 884
2 SASI_Hs01_00164229 predicted 855
3 SASI_Hs01_00164232 predicted 895
4 SASI_Hs01_00164234 predicted 484
5 SASI_Hs02_00356495 predicted 886
6 SASI_Hs02_00356496 predicted 803
7 SASI_Hs02_00356497 predicted 480
8 SASI_Hs02_00356498 predicted 429
9 SASI_Hs02_00356499 predicted 929
10 SASI_Hs02_00356500 predicted 929
11 SASI_Hs01_00164227 predicted 501
12 SASI_Hs01_00164228 predicted 713
13 SASI_Hs01_00164230 predicted 500
14 SASI_Hs01_00164231 predicted 709
15 SASI_Hs01_00164233 predicted 621
16 SASI_Hs01_00164235 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240509 predicted 473
2 SASI_Rn02_00240510 predicted 437
3 SASI_Rn02_00240511 predicted 573
4 SASI_Rn02_00240512 predicted 592
5 SASI_Rn02_00240513 predicted 422
6 SASI_Rn02_00240514 predicted 792
7 SASI_Rn02_00240515 predicted 618
8 SASI_Rn02_00240516 predicted 697
9 SASI_Rn02_00240517 predicted 431
10 SASI_Rn02_00240518 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024051
VALIDATED
GGCT MISSION shRNA Bacterial Glycerol Stock
gamma-glutamylcyclotransferase
Human
21 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024051.2-586s1c1
Sequence:CCGGGCTGGAGTATCAAGAGAAGTTCTCGAGAACTTCTCTTGATACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024051.2-945s1c1
Sequence:CCGGCTGAAAGCTATTCTCTTGAATCTCGAGATTCAAGAGAATAGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024051.2-611s1c1
Sequence:CCGGGCAATAGAACCAAATGACTATCTCGAGATAGTCATTTGGTTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024051.2-550s1c1
Sequence:CCGGGATTATTTGCATGGGTGCAAACTCGAGTTTGCACCCATGCAAATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142126    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024051.2-801s1c1
Sequence:CCGGGTGCTCTGAAGGAGTATCTTACTCGAGTAAGATACTCCTTCAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024051.2-283s1c1
Sequence:CCGGCTTTGGCAATTCCCAAGGCAACTCGAGTTGCCTTGGGAATTGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024051.2-311s1c1
Sequence:CCGGCAAACTTGGCATGGAGGGATACTCGAGTATCCCTCCATGCCAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024051.2-306s1c1
Sequence:CCGGCAAGTCAAACTTGGCATGGAGCTCGAGCTCCATGCCAAGTTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024051.2-585s1c1
Sequence:CCGGCGCTGGAGTATCAAGAGAAGTCTCGAGACTTCTCTTGATACTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024051.2-859s1c1
Sequence:CCGGCTGGGATAGGAGTTAGACAATCTCGAGATTGTCTAACTCCTATCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024051.2-278s1c1
Sequence:CCGGCTTGACTTTGGCAATTCCCAACTCGAGTTGGGAATTGCCAAAGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024051.2-626s1c1
Sequence:CCGGGACTATACAGGAAAGGTCTCACTCGAGTGAGACCTTTCCTGTATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024051.2-712s1c1
Sequence:CCGGCTAAGGGTATTCTATGTGCTACTCGAGTAGCACATAGAATACCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024051.2-587s1c1
Sequence:CCGGCTGGAGTATCAAGAGAAGTTACTCGAGTAACTTCTCTTGATACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024051.2-617s1c1
Sequence:CCGGGAACCAAATGACTATACAGGACTCGAGTCCTGTATAGTCATTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024051.2-812s1c1
Sequence:CCGGGAGTATCTTACTTGGGTGATTCTCGAGAATCACCCAAGTAAGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024051.2-812s21c1
Sequence:CCGGGAGTATCTTACTTGGGTGATTCTCGAGAATCACCCAAGTAAGATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024051.2-859s21c1
Sequence:CCGGCTGGGATAGGAGTTAGACAATCTCGAGATTGTCTAACTCCTATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024051.2-586s21c1
Sequence:CCGGGCTGGAGTATCAAGAGAAGTTCTCGAGAACTTCTCTTGATACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024051.2-611s21c1
Sequence:CCGGGCAATAGAACCAAATGACTATCTCGAGATAGTCATTTGGTTCTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024051.2-801s21c1
Sequence:CCGGGTGCTCTGAAGGAGTATCTTACTCGAGTAAGATACTCCTTCAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024051
VALIDATED
GGCT MISSION shRNA shRNA Plasmid DNA
gamma-glutamylcyclotransferase
Human
21 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024051.2-586s1c1
Sequence:CCGGGCTGGAGTATCAAGAGAAGTTCTCGAGAACTTCTCTTGATACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024051.2-945s1c1
Sequence:CCGGCTGAAAGCTATTCTCTTGAATCTCGAGATTCAAGAGAATAGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024051.2-611s1c1
Sequence:CCGGGCAATAGAACCAAATGACTATCTCGAGATAGTCATTTGGTTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024051.2-550s1c1
Sequence:CCGGGATTATTTGCATGGGTGCAAACTCGAGTTTGCACCCATGCAAATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142126    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024051.2-801s1c1
Sequence:CCGGGTGCTCTGAAGGAGTATCTTACTCGAGTAAGATACTCCTTCAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024051.2-283s1c1
Sequence:CCGGCTTTGGCAATTCCCAAGGCAACTCGAGTTGCCTTGGGAATTGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024051.2-311s1c1
Sequence:CCGGCAAACTTGGCATGGAGGGATACTCGAGTATCCCTCCATGCCAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024051.2-306s1c1
Sequence:CCGGCAAGTCAAACTTGGCATGGAGCTCGAGCTCCATGCCAAGTTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024051.2-585s1c1
Sequence:CCGGCGCTGGAGTATCAAGAGAAGTCTCGAGACTTCTCTTGATACTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024051.2-859s1c1
Sequence:CCGGCTGGGATAGGAGTTAGACAATCTCGAGATTGTCTAACTCCTATCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024051.2-278s1c1
Sequence:CCGGCTTGACTTTGGCAATTCCCAACTCGAGTTGGGAATTGCCAAAGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024051.2-626s1c1
Sequence:CCGGGACTATACAGGAAAGGTCTCACTCGAGTGAGACCTTTCCTGTATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024051.2-712s1c1
Sequence:CCGGCTAAGGGTATTCTATGTGCTACTCGAGTAGCACATAGAATACCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024051.2-587s1c1
Sequence:CCGGCTGGAGTATCAAGAGAAGTTACTCGAGTAACTTCTCTTGATACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024051.2-617s1c1
Sequence:CCGGGAACCAAATGACTATACAGGACTCGAGTCCTGTATAGTCATTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024051.2-812s1c1
Sequence:CCGGGAGTATCTTACTTGGGTGATTCTCGAGAATCACCCAAGTAAGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024051.2-812s21c1
Sequence:CCGGGAGTATCTTACTTGGGTGATTCTCGAGAATCACCCAAGTAAGATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024051.2-859s21c1
Sequence:CCGGCTGGGATAGGAGTTAGACAATCTCGAGATTGTCTAACTCCTATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024051.2-586s21c1
Sequence:CCGGGCTGGAGTATCAAGAGAAGTTCTCGAGAACTTCTCTTGATACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024051.2-611s21c1
Sequence:CCGGGCAATAGAACCAAATGACTATCTCGAGATAGTCATTTGGTTCTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024051.2-801s21c1
Sequence:CCGGGTGCTCTGAAGGAGTATCTTACTCGAGTAAGATACTCCTTCAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024051
VALIDATED
GGCT MISSION shRNA Lentiviral Transduction Particles
gamma-glutamylcyclotransferase
Human
21 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024051.2-586s1c1
Sequence:CCGGGCTGGAGTATCAAGAGAAGTTCTCGAGAACTTCTCTTGATACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024051.2-945s1c1
Sequence:CCGGCTGAAAGCTATTCTCTTGAATCTCGAGATTCAAGAGAATAGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024051.2-611s1c1
Sequence:CCGGGCAATAGAACCAAATGACTATCTCGAGATAGTCATTTGGTTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024051.2-550s1c1
Sequence:CCGGGATTATTTGCATGGGTGCAAACTCGAGTTTGCACCCATGCAAATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142126    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024051.2-801s1c1
Sequence:CCGGGTGCTCTGAAGGAGTATCTTACTCGAGTAAGATACTCCTTCAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024051.2-283s1c1
Sequence:CCGGCTTTGGCAATTCCCAAGGCAACTCGAGTTGCCTTGGGAATTGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024051.2-311s1c1
Sequence:CCGGCAAACTTGGCATGGAGGGATACTCGAGTATCCCTCCATGCCAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024051.2-306s1c1
Sequence:CCGGCAAGTCAAACTTGGCATGGAGCTCGAGCTCCATGCCAAGTTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024051.2-585s1c1
Sequence:CCGGCGCTGGAGTATCAAGAGAAGTCTCGAGACTTCTCTTGATACTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024051.2-859s1c1
Sequence:CCGGCTGGGATAGGAGTTAGACAATCTCGAGATTGTCTAACTCCTATCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024051.2-278s1c1
Sequence:CCGGCTTGACTTTGGCAATTCCCAACTCGAGTTGGGAATTGCCAAAGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024051.2-626s1c1
Sequence:CCGGGACTATACAGGAAAGGTCTCACTCGAGTGAGACCTTTCCTGTATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024051.2-712s1c1
Sequence:CCGGCTAAGGGTATTCTATGTGCTACTCGAGTAGCACATAGAATACCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024051.2-587s1c1
Sequence:CCGGCTGGAGTATCAAGAGAAGTTACTCGAGTAACTTCTCTTGATACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024051.2-617s1c1
Sequence:CCGGGAACCAAATGACTATACAGGACTCGAGTCCTGTATAGTCATTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024051.2-812s1c1
Sequence:CCGGGAGTATCTTACTTGGGTGATTCTCGAGAATCACCCAAGTAAGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024051.2-812s21c1
Sequence:CCGGGAGTATCTTACTTGGGTGATTCTCGAGAATCACCCAAGTAAGATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024051.2-859s21c1
Sequence:CCGGCTGGGATAGGAGTTAGACAATCTCGAGATTGTCTAACTCCTATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024051.2-586s21c1
Sequence:CCGGGCTGGAGTATCAAGAGAAGTTCTCGAGAACTTCTCTTGATACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024051.2-611s21c1
Sequence:CCGGGCAATAGAACCAAATGACTATCTCGAGATAGTCATTTGGTTCTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024051.2-801s21c1
Sequence:CCGGGTGCTCTGAAGGAGTATCTTACTCGAGTAAGATACTCCTTCAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks