EMAIL THIS PAGE TO A FRIEND

GGCX

gamma-glutamyl carboxylase

52 Gene Product Result for
Synonyms: VKCFD1
UniProtKB ID: P38435, B4DMC5, E9PEE1, Q14415, Q6GU45
Gene ID:
Human(2677) Summary: This gene encodes an enzyme which catalyzes the posttranslational modification of vitamin K-dependent protein. Many of these vitamin K-dependent proteins are involved in coagulation so the function of the encoded enzyme is essential for hemostasis. Mutations in this gene are associated with vitamin K-dependent coagulation defect and PXE-like disorder with multiple coagulation factor deficiency. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2008]
Mouse(56316) gamma-glutamyl carboxylase
Rat(81716) gamma-glutamyl carboxylase
Zebrafish(557240) gamma-glutamyl carboxylase
cow(281190) gamma-glutamyl carboxylase
domestic cat(101085622) gamma-glutamyl carboxylase
dog(475769) gamma-glutamyl carboxylase
naked mole-rat(101703456) gamma-glutamyl carboxylase
domestic guinea pig(100730272) gamma-glutamyl carboxylase
sheep(443129) gamma-glutamyl carboxylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019802 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019802 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019802 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000821 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000821 Rosetta Predictions human pricing
NM_031756 Rosetta Predictions rat pricing
NM_019802 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088048 predicted 2121
2 SASI_Hs02_00303297 predicted 1791
3 SASI_Hs01_00088049 predicted 2020
4 SASI_Hs01_00088050 predicted 356
5 SASI_Hs01_00088052 predicted 515
6 SASI_Hs02_00303298 predicted 660
7 SASI_Hs02_00303299 predicted 239
8 SASI_Hs01_00088053 predicted 1409
9 SASI_Hs01_00088055 predicted 908
10 SASI_Hs01_00088056 predicted 1776
11 SASI_Hs01_00088051 predicted 1143
12 SASI_Hs01_00088054 predicted 1187
13 SASI_Hs01_00088057 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070053 predicted 1752
2 SASI_Rn01_00070054 predicted 2313
3 SASI_Rn01_00070055 predicted 1818
4 SASI_Rn01_00070056 predicted 2089
5 SASI_Rn01_00070057 predicted 561
6 SASI_Rn01_00070058 predicted 256
7 SASI_Rn01_00070059 predicted 689
8 SASI_Rn01_00070060 predicted 399
9 SASI_Rn01_00070061 predicted 318
10 SASI_Rn02_00265170 predicted 2287
11 SASI_Rn01_00070062 predicted 1835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019802 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325045 predicted 1756
2 SASI_Mm02_00325046 predicted 2308
3 SASI_Mm02_00325047 predicted 1819
4 SASI_Mm02_00325048 predicted 565
5 SASI_Mm02_00325049 predicted 1461
6 SASI_Mm02_00325050 predicted 317
7 SASI_Mm02_00325051 predicted 1610
8 SASI_Mm02_00325052 predicted 1831
9 SASI_Mm02_00325053 predicted 959
10 SASI_Mm02_00325054 predicted 2246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019802
VALIDATED
GGCX MISSION shRNA Bacterial Glycerol Stock
gamma-glutamyl carboxylase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019802.4-2381s21c1
Sequence:CCGGGCAGCCTGTTATAGGCTTATTCTCGAGAATAAGCCTATAACAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019802.4-1580s21c1
Sequence:CCGGGCAGCCACTCTTGATGGATTTCTCGAGAAATCCATCAAGAGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019802.4-111s21c1
Sequence:CCGGGCCTCAGATAAAGTACAGAAACTCGAGTTTCTGTACTTTATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019802.4-1916s21c1
Sequence:CCGGCCTGGCATATCTGCAAGAATTCTCGAGAATTCTTGCAGATATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019802.4-2250s21c1
Sequence:CCGGCGACCATTTGAACCAGTTGATCTCGAGATCAACTGGTTCAAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019802.1-2381s1c1
Sequence:CCGGGCAGCCTGTTATAGGCTTATTCTCGAGAATAAGCCTATAACAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019802.1-111s1c1
Sequence:CCGGGCCTCAGATAAAGTACAGAAACTCGAGTTTCTGTACTTTATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019802.1-1916s1c1
Sequence:CCGGCCTGGCATATCTGCAAGAATTCTCGAGAATTCTTGCAGATATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019802.1-1580s1c1
Sequence:CCGGGCAGCCACTCTTGATGGATTTCTCGAGAAATCCATCAAGAGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019802.1-2250s1c1
Sequence:CCGGCGACCATTTGAACCAGTTGATCTCGAGATCAACTGGTTCAAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019802
VALIDATED
GGCX MISSION shRNA shRNA Plasmid DNA
gamma-glutamyl carboxylase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019802.4-2381s21c1
Sequence:CCGGGCAGCCTGTTATAGGCTTATTCTCGAGAATAAGCCTATAACAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019802.4-1580s21c1
Sequence:CCGGGCAGCCACTCTTGATGGATTTCTCGAGAAATCCATCAAGAGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019802.4-111s21c1
Sequence:CCGGGCCTCAGATAAAGTACAGAAACTCGAGTTTCTGTACTTTATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019802.4-1916s21c1
Sequence:CCGGCCTGGCATATCTGCAAGAATTCTCGAGAATTCTTGCAGATATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019802.4-2250s21c1
Sequence:CCGGCGACCATTTGAACCAGTTGATCTCGAGATCAACTGGTTCAAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019802.1-2381s1c1
Sequence:CCGGGCAGCCTGTTATAGGCTTATTCTCGAGAATAAGCCTATAACAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019802.1-111s1c1
Sequence:CCGGGCCTCAGATAAAGTACAGAAACTCGAGTTTCTGTACTTTATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019802.1-1916s1c1
Sequence:CCGGCCTGGCATATCTGCAAGAATTCTCGAGAATTCTTGCAGATATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019802.1-1580s1c1
Sequence:CCGGGCAGCCACTCTTGATGGATTTCTCGAGAAATCCATCAAGAGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019802.1-2250s1c1
Sequence:CCGGCGACCATTTGAACCAGTTGATCTCGAGATCAACTGGTTCAAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019802
VALIDATED
GGCX MISSION shRNA Lentiviral Transduction Particles
gamma-glutamyl carboxylase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019802.4-2381s21c1
Sequence:CCGGGCAGCCTGTTATAGGCTTATTCTCGAGAATAAGCCTATAACAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019802.4-1580s21c1
Sequence:CCGGGCAGCCACTCTTGATGGATTTCTCGAGAAATCCATCAAGAGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019802.4-111s21c1
Sequence:CCGGGCCTCAGATAAAGTACAGAAACTCGAGTTTCTGTACTTTATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019802.4-1916s21c1
Sequence:CCGGCCTGGCATATCTGCAAGAATTCTCGAGAATTCTTGCAGATATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019802.4-2250s21c1
Sequence:CCGGCGACCATTTGAACCAGTTGATCTCGAGATCAACTGGTTCAAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019802.1-2381s1c1
Sequence:CCGGGCAGCCTGTTATAGGCTTATTCTCGAGAATAAGCCTATAACAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019802.1-111s1c1
Sequence:CCGGGCCTCAGATAAAGTACAGAAACTCGAGTTTCTGTACTTTATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019802.1-1916s1c1
Sequence:CCGGCCTGGCATATCTGCAAGAATTCTCGAGAATTCTTGCAGATATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019802.1-1580s1c1
Sequence:CCGGGCAGCCACTCTTGATGGATTTCTCGAGAAATCCATCAAGAGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019802.1-2250s1c1
Sequence:CCGGCGACCATTTGAACCAGTTGATCTCGAGATCAACTGGTTCAAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000821
VALIDATED
GGCX MISSION shRNA Bacterial Glycerol Stock
gamma-glutamyl carboxylase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000821.4-2079s21c1
Sequence:CCGGCCTTTCTTAGACGCCAACAAACTCGAGTTTGTTGGCGTCTAAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000821.4-1122s21c1
Sequence:CCGGCCAGTGTTTCCTGTGTGTATACTCGAGTATACACACAGGAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000821.4-616s21c1
Sequence:CCGGGCTAACATTCATGGATGCAAACTCGAGTTTGCATCCATGAATGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000821.4-511s21c1
Sequence:CCGGCCGGATAAGCTGTGTGTTATTCTCGAGAATAACACACAGCTTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000821.4-2120s21c1
Sequence:CCGGCGGCGAAATACTCCTTTCCATCTCGAGATGGAAAGGAGTATTTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000821.2-547s1c1
Sequence:CCGGGCTAACATTCATGGATGCAAACTCGAGTTTGCATCCATGAATGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000821.2-2010s1c1
Sequence:CCGGCCTTTCTTAGACGCCAACAAACTCGAGTTTGTTGGCGTCTAAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000821.2-442s1c1
Sequence:CCGGCCGGATAAGCTGTGTGTTATTCTCGAGAATAACACACAGCTTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000821.2-1053s1c1
Sequence:CCGGCCAGTGTTTCCTGTGTGTATACTCGAGTATACACACAGGAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000821.2-2051s1c1
Sequence:CCGGCGGCGAAATACTCCTTTCCATCTCGAGATGGAAAGGAGTATTTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000821
VALIDATED
GGCX MISSION shRNA shRNA Plasmid DNA
gamma-glutamyl carboxylase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000821.4-2079s21c1
Sequence:CCGGCCTTTCTTAGACGCCAACAAACTCGAGTTTGTTGGCGTCTAAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000821.4-1122s21c1
Sequence:CCGGCCAGTGTTTCCTGTGTGTATACTCGAGTATACACACAGGAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000821.4-616s21c1
Sequence:CCGGGCTAACATTCATGGATGCAAACTCGAGTTTGCATCCATGAATGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000821.4-511s21c1
Sequence:CCGGCCGGATAAGCTGTGTGTTATTCTCGAGAATAACACACAGCTTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000821.4-2120s21c1
Sequence:CCGGCGGCGAAATACTCCTTTCCATCTCGAGATGGAAAGGAGTATTTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000821.2-547s1c1
Sequence:CCGGGCTAACATTCATGGATGCAAACTCGAGTTTGCATCCATGAATGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000821.2-2010s1c1
Sequence:CCGGCCTTTCTTAGACGCCAACAAACTCGAGTTTGTTGGCGTCTAAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000821.2-442s1c1
Sequence:CCGGCCGGATAAGCTGTGTGTTATTCTCGAGAATAACACACAGCTTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000821.2-1053s1c1
Sequence:CCGGCCAGTGTTTCCTGTGTGTATACTCGAGTATACACACAGGAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000821.2-2051s1c1
Sequence:CCGGCGGCGAAATACTCCTTTCCATCTCGAGATGGAAAGGAGTATTTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000821
VALIDATED
GGCX MISSION shRNA Lentiviral Transduction Particles
gamma-glutamyl carboxylase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000821.4-2079s21c1
Sequence:CCGGCCTTTCTTAGACGCCAACAAACTCGAGTTTGTTGGCGTCTAAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000821.4-1122s21c1
Sequence:CCGGCCAGTGTTTCCTGTGTGTATACTCGAGTATACACACAGGAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000821.4-616s21c1
Sequence:CCGGGCTAACATTCATGGATGCAAACTCGAGTTTGCATCCATGAATGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000821.4-511s21c1
Sequence:CCGGCCGGATAAGCTGTGTGTTATTCTCGAGAATAACACACAGCTTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000821.4-2120s21c1
Sequence:CCGGCGGCGAAATACTCCTTTCCATCTCGAGATGGAAAGGAGTATTTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000821.2-547s1c1
Sequence:CCGGGCTAACATTCATGGATGCAAACTCGAGTTTGCATCCATGAATGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000821.2-2010s1c1
Sequence:CCGGCCTTTCTTAGACGCCAACAAACTCGAGTTTGTTGGCGTCTAAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000821.2-442s1c1
Sequence:CCGGCCGGATAAGCTGTGTGTTATTCTCGAGAATAACACACAGCTTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000821.2-1053s1c1
Sequence:CCGGCCAGTGTTTCCTGTGTGTATACTCGAGTATACACACAGGAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000821.2-2051s1c1
Sequence:CCGGCGGCGAAATACTCCTTTCCATCTCGAGATGGAAAGGAGTATTTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks