EMAIL THIS PAGE TO A FRIEND

GGH

gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)

53 Gene Product Result for
Synonyms: GH
UniProtKB ID: Q92820
Gene ID:
Human(8836) Summary: This gene catalyzes the hydrolysis of folylpoly-gamma-glutamates and antifolylpoly-gamma-glutamates by the removal of gamma-linked polyglutamates and glutamate. [provided by RefSeq, Jul 2008]
Mouse(14590) gamma-glutamyl hydrolase
Rat(25455) gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
sheep(101118706) gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
domestic guinea pig(100719750) gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
naked mole-rat(101724155) gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
Zebrafish(406624) gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
cow(525303) gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
domestic cat(101100943) gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
dog(477896) gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
chicken(421144) gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003878 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003878 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003878 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010281 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010281 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010281 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023291 MISSION® esiRNA esiRNA human GGH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003878 Rosetta Predictions human pricing
NM_012960 Rosetta Predictions rat pricing
NM_010281 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166929 predicted 289
2 SASI_Hs01_00166930 predicted 804
3 SASI_Hs01_00166931 predicted 216
4 SASI_Hs01_00166932 predicted 811
5 SASI_Hs01_00166933 predicted 270
6 SASI_Hs01_00166934 predicted 470
7 SASI_Hs01_00166935 predicted 934
8 SASI_Hs01_00166936 predicted 207
9 SASI_Hs01_00166937 predicted 989
10 SASI_Hs02_00336472 predicted 492
11 SASI_Hs01_00166928 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081895 predicted 1028
2 SASI_Rn01_00081896 predicted 898
3 SASI_Rn01_00081897 predicted 666
4 SASI_Rn01_00081898 predicted 316
5 SASI_Rn01_00081899 predicted 621
6 SASI_Rn01_00081901 predicted 589
7 SASI_Rn01_00081902 predicted 609
8 SASI_Rn01_00081903 predicted 448
9 SASI_Rn01_00081904 predicted 836
10 SASI_Rn02_00260562 predicted 887
11 SASI_Rn01_00081900 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010281 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318220 predicted 224
2 SASI_Mm01_00046254 predicted 900
3 SASI_Mm01_00046255 predicted 970
4 SASI_Mm01_00046257 predicted 812
5 SASI_Mm01_00046258 predicted 213
6 SASI_Mm01_00046259 predicted 1072
7 SASI_Mm01_00046260 predicted 422
8 SASI_Mm01_00046261 predicted 287
9 SASI_Mm01_00046262 predicted 557
10 SASI_Mm01_00046263 predicted 801
11 SASI_Mm01_00046256 predicted 471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003878
VALIDATED
GGH MISSION shRNA Bacterial Glycerol Stock
gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003878.1-502s1c1
Sequence:CCGGGCTTATTAACTGCCACAGATACTCGAGTATCTGTGGCAGTTAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003878.1-959s1c1
Sequence:CCGGCAGTCCAATTTATACTGGAAACTCGAGTTTCCAGTATAAATTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003878.1-723s1c1
Sequence:CCGGGATGGCAAGATTGAGTTTATTCTCGAGAATAAACTCAATCTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003878.1-836s1c1
Sequence:CCGGCCATGCACCTAATGCTGTGAACTCGAGTTCACAGCATTAGGTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003878.2-1060s21c1
Sequence:CCGGCCATGCACCTAATGCTGTGAACTCGAGTTCACAGCATTAGGTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003878.2-947s21c1
Sequence:CCGGGATGGCAAGATTGAGTTTATTCTCGAGAATAAACTCAATCTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003878.2-486s21c1
Sequence:CCGGGTGCGAGAGTTGTACCAGTAACTCGAGTTACTGGTACAACTCTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003878.2-726s21c1
Sequence:CCGGGCTTATTAACTGCCACAGATACTCGAGTATCTGTGGCAGTTAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003878
VALIDATED
GGH MISSION shRNA shRNA Plasmid DNA
gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003878.1-502s1c1
Sequence:CCGGGCTTATTAACTGCCACAGATACTCGAGTATCTGTGGCAGTTAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003878.1-959s1c1
Sequence:CCGGCAGTCCAATTTATACTGGAAACTCGAGTTTCCAGTATAAATTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003878.1-723s1c1
Sequence:CCGGGATGGCAAGATTGAGTTTATTCTCGAGAATAAACTCAATCTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003878.1-836s1c1
Sequence:CCGGCCATGCACCTAATGCTGTGAACTCGAGTTCACAGCATTAGGTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003878.2-1060s21c1
Sequence:CCGGCCATGCACCTAATGCTGTGAACTCGAGTTCACAGCATTAGGTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003878.2-947s21c1
Sequence:CCGGGATGGCAAGATTGAGTTTATTCTCGAGAATAAACTCAATCTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003878.2-486s21c1
Sequence:CCGGGTGCGAGAGTTGTACCAGTAACTCGAGTTACTGGTACAACTCTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003878.2-726s21c1
Sequence:CCGGGCTTATTAACTGCCACAGATACTCGAGTATCTGTGGCAGTTAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003878
VALIDATED
GGH MISSION shRNA Lentiviral Transduction Particles
gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003878.1-502s1c1
Sequence:CCGGGCTTATTAACTGCCACAGATACTCGAGTATCTGTGGCAGTTAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003878.1-959s1c1
Sequence:CCGGCAGTCCAATTTATACTGGAAACTCGAGTTTCCAGTATAAATTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003878.1-723s1c1
Sequence:CCGGGATGGCAAGATTGAGTTTATTCTCGAGAATAAACTCAATCTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003878.1-836s1c1
Sequence:CCGGCCATGCACCTAATGCTGTGAACTCGAGTTCACAGCATTAGGTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003878.2-1060s21c1
Sequence:CCGGCCATGCACCTAATGCTGTGAACTCGAGTTCACAGCATTAGGTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003878.2-947s21c1
Sequence:CCGGGATGGCAAGATTGAGTTTATTCTCGAGAATAAACTCAATCTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003878.2-486s21c1
Sequence:CCGGGTGCGAGAGTTGTACCAGTAACTCGAGTTACTGGTACAACTCTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003878.2-726s21c1
Sequence:CCGGGCTTATTAACTGCCACAGATACTCGAGTATCTGTGGCAGTTAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010281
VALIDATED
GGH MISSION shRNA Bacterial Glycerol Stock
gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010281.1-1043s1c1
Sequence:CCGGGCTTTGAGTAATTCTGTGATTCTCGAGAATCACAGAATTACTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010281.1-802s1c1
Sequence:CCGGGCACCATTTGAGTGGAAGAATCTCGAGATTCTTCCACTCAAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010281.1-229s1c1
Sequence:CCGGGCTGCATCCTATGTGAAGTATCTCGAGATACTTCACATAGGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010281.1-828s1c1
Sequence:CCGGCGGCATTTCTCATGCACCAAACTCGAGTTTGGTGCATGAGAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010281.1-422s1c1
Sequence:CCGGGCTTTGATAATGGAGGCCATTCTCGAGAATGGCCTCCATTATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010281
VALIDATED
GGH MISSION shRNA shRNA Plasmid DNA
gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010281.1-1043s1c1
Sequence:CCGGGCTTTGAGTAATTCTGTGATTCTCGAGAATCACAGAATTACTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010281.1-802s1c1
Sequence:CCGGGCACCATTTGAGTGGAAGAATCTCGAGATTCTTCCACTCAAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010281.1-229s1c1
Sequence:CCGGGCTGCATCCTATGTGAAGTATCTCGAGATACTTCACATAGGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010281.1-828s1c1
Sequence:CCGGCGGCATTTCTCATGCACCAAACTCGAGTTTGGTGCATGAGAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010281.1-422s1c1
Sequence:CCGGGCTTTGATAATGGAGGCCATTCTCGAGAATGGCCTCCATTATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010281
VALIDATED
GGH MISSION shRNA Lentiviral Transduction Particles
gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010281.1-1043s1c1
Sequence:CCGGGCTTTGAGTAATTCTGTGATTCTCGAGAATCACAGAATTACTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010281.1-802s1c1
Sequence:CCGGGCACCATTTGAGTGGAAGAATCTCGAGATTCTTCCACTCAAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010281.1-229s1c1
Sequence:CCGGGCTGCATCCTATGTGAAGTATCTCGAGATACTTCACATAGGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010281.1-828s1c1
Sequence:CCGGCGGCATTTCTCATGCACCAAACTCGAGTTTGGTGCATGAGAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010281.1-422s1c1
Sequence:CCGGGCTTTGATAATGGAGGCCATTCTCGAGAATGGCCTCCATTATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks