EMAIL THIS PAGE TO A FRIEND

GGN

gametogenetin

61 Gene Product Result for
UniProtKB ID: Q86UU5, Q7RTU6, Q86UU4, Q8NAA1
Gene ID:
Human(199720) Summary: This gene is a germ cell-specific gene that encodes proteins that interact with POG (proliferation of germ cells). Alternatively spliced transcript variants of a similar mouse gene encode at least three different proteins, namely gametogenetin protein 1a, gametogenetin protein 2, and gametogenetin protein 3, which show a perinuclear, cytoplasmic, and nucleolar localization, respectively. These proteins regulate the localization of POG and may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
Mouse(243897) gametogenetin
Rat(292765) gametogenetin
sheep(101111826) gametogenetin
cow(100140305) gametogenetin
domestic cat(101095214) gametogenetin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408430 Anti-GGN antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2103697 Anti-GGN, (N-terminal) antibody produced in rabbit affinity isolated antibody human, canine, bovine, mouse, guinea pig, rabbit, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182694 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182694 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182694 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152657 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146551 MISSION® esiRNA esiRNA human GGN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152657 Rosetta Predictions human pricing
NM_001013065 Rosetta Predictions rat pricing
NM_182694 Rosetta Predictions mouse pricing
NM_182696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082748 predicted 1171
2 SASI_Hs01_00082750 predicted 1211
3 SASI_Hs01_00082751 predicted 1177
4 SASI_Hs01_00082752 predicted 360
5 SASI_Hs01_00082754 predicted 573
6 SASI_Hs02_00366546 predicted 576
7 SASI_Hs02_00366547 predicted 862
8 SASI_Hs01_00082755 predicted 1172
9 SASI_Hs02_00366548 predicted 573
10 SASI_Hs01_00082756 predicted 831
11 SASI_Hs01_00082749 predicted 852
12 SASI_Hs01_00082753 predicted 1081
13 SASI_Hs01_00082757 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013065 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057185 predicted 1040
2 SASI_Rn01_00057186 predicted 1433
3 SASI_Rn01_00057187 predicted 2179
4 SASI_Rn02_00200687 predicted 1433
5 SASI_Rn01_00057188 predicted 981
6 SASI_Rn01_00057189 predicted 1210
7 SASI_Rn01_00057190 predicted 1398
8 SASI_Rn01_00057191 predicted 2040
9 SASI_Rn01_00057192 predicted 430
10 SASI_Rn02_00200688 predicted 1041
11 SASI_Rn01_00057193 predicted 2140
12 SASI_Rn01_00057194 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193330 predicted 2383
2 SASI_Mm01_00193331 predicted 2371
3 SASI_Mm01_00193332 predicted 2383
4 SASI_Mm01_00193334 predicted 2374
5 SASI_Mm01_00193335 predicted 2376
6 SASI_Mm01_00193336 predicted 2362
7 SASI_Mm01_00193337 predicted 2377
8 SASI_Mm01_00193338 predicted 2373
9 SASI_Mm01_00193339 predicted 2326
10 SASI_Mm02_00349952 predicted 2351
11 SASI_Mm01_00193333 predicted 1903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068814 predicted 338
2 SASI_Mm01_00068815 predicted 323
3 SASI_Mm01_00068816 predicted 334
4 SASI_Mm01_00068818 predicted 327
5 SASI_Mm01_00068819 predicted 333
6 SASI_Mm01_00068820 predicted 321
7 SASI_Mm01_00068821 predicted 335
8 SASI_Mm01_00068822 predicted 331
9 SASI_Mm01_00068823 predicted 274
10 SASI_Mm02_00349953 predicted 304
11 SASI_Mm01_00068817 predicted 365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182694
GGN MISSION shRNA Bacterial Glycerol Stock
gametogenetin
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182694.2-1849s21c1
Sequence:CCGGCATCTTCCCAGCGCCAAACAACTCGAGTTGTTTGGCGCTGGGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182694.2-1633s21c1
Sequence:CCGGCCCAGGTTCAAAGCCCAAATTCTCGAGAATTTGGGCTTTGAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182694.2-2196s21c1
Sequence:CCGGCTCGTACACGCAGGAACAAAGCTCGAGCTTTGTTCCTGCGTGTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182694.2-2384s21c1
Sequence:CCGGCCGCCTTTCGAGGTGCTTAATCTCGAGATTAAGCACCTCGAAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182694.1-783s1c1
Sequence:CCGGGCTGTGCAAAGTCACCTTCAACTCGAGTTGAAGGTGACTTTGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182694.1-1171s1c1
Sequence:CCGGGAACGGCATTTCCGATTCAATCTCGAGATTGAATCGGAAATGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182694.1-1122s1c1
Sequence:CCGGCCCAGGTTCAAAGCCCAAATTCTCGAGAATTTGGGCTTTGAACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182694
GGN MISSION shRNA shRNA Plasmid DNA
gametogenetin
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182694.2-1849s21c1
Sequence:CCGGCATCTTCCCAGCGCCAAACAACTCGAGTTGTTTGGCGCTGGGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182694.2-1633s21c1
Sequence:CCGGCCCAGGTTCAAAGCCCAAATTCTCGAGAATTTGGGCTTTGAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182694.2-2196s21c1
Sequence:CCGGCTCGTACACGCAGGAACAAAGCTCGAGCTTTGTTCCTGCGTGTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182694.2-2384s21c1
Sequence:CCGGCCGCCTTTCGAGGTGCTTAATCTCGAGATTAAGCACCTCGAAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182694.1-783s1c1
Sequence:CCGGGCTGTGCAAAGTCACCTTCAACTCGAGTTGAAGGTGACTTTGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182694.1-1171s1c1
Sequence:CCGGGAACGGCATTTCCGATTCAATCTCGAGATTGAATCGGAAATGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182694.1-1122s1c1
Sequence:CCGGCCCAGGTTCAAAGCCCAAATTCTCGAGAATTTGGGCTTTGAACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182694
GGN MISSION shRNA Lentiviral Transduction Particles
gametogenetin
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182694.2-1849s21c1
Sequence:CCGGCATCTTCCCAGCGCCAAACAACTCGAGTTGTTTGGCGCTGGGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182694.2-1633s21c1
Sequence:CCGGCCCAGGTTCAAAGCCCAAATTCTCGAGAATTTGGGCTTTGAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182694.2-2196s21c1
Sequence:CCGGCTCGTACACGCAGGAACAAAGCTCGAGCTTTGTTCCTGCGTGTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182694.2-2384s21c1
Sequence:CCGGCCGCCTTTCGAGGTGCTTAATCTCGAGATTAAGCACCTCGAAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182694.1-783s1c1
Sequence:CCGGGCTGTGCAAAGTCACCTTCAACTCGAGTTGAAGGTGACTTTGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182694.1-1171s1c1
Sequence:CCGGGAACGGCATTTCCGATTCAATCTCGAGATTGAATCGGAAATGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182694.1-1122s1c1
Sequence:CCGGCCCAGGTTCAAAGCCCAAATTCTCGAGAATTTGGGCTTTGAACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152657
GGN MISSION shRNA Bacterial Glycerol Stock
gametogenetin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152657.3-1179s21c1
Sequence:CCGGGCCCAAATTCGACTGGGTTAGCTCGAGCTAACCCAGTCGAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152657.3-1906s21c1
Sequence:CCGGTCCTGTCCCTGCAAGTGTTACCTCGAGGTAACACTTGCAGGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152657.3-969s21c1
Sequence:CCGGTGCCTCAGGTGCCATCTCTTACTCGAGTAAGAGATGGCACCTGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152657.3-586s21c1
Sequence:CCGGCTATCCGTGAAGGACACTGTCCTCGAGGACAGTGTCCTTCACGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152657.3-874s21c1
Sequence:CCGGTTCAAGTCGAGGCCCTCTTTGCTCGAGCAAAGAGGGCCTCGACTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152657
GGN MISSION shRNA shRNA Plasmid DNA
gametogenetin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152657.3-1179s21c1
Sequence:CCGGGCCCAAATTCGACTGGGTTAGCTCGAGCTAACCCAGTCGAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152657.3-1906s21c1
Sequence:CCGGTCCTGTCCCTGCAAGTGTTACCTCGAGGTAACACTTGCAGGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152657.3-969s21c1
Sequence:CCGGTGCCTCAGGTGCCATCTCTTACTCGAGTAAGAGATGGCACCTGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152657.3-586s21c1
Sequence:CCGGCTATCCGTGAAGGACACTGTCCTCGAGGACAGTGTCCTTCACGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152657.3-874s21c1
Sequence:CCGGTTCAAGTCGAGGCCCTCTTTGCTCGAGCAAAGAGGGCCTCGACTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152657
GGN MISSION shRNA Lentiviral Transduction Particles
gametogenetin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152657.3-1179s21c1
Sequence:CCGGGCCCAAATTCGACTGGGTTAGCTCGAGCTAACCCAGTCGAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152657.3-1906s21c1
Sequence:CCGGTCCTGTCCCTGCAAGTGTTACCTCGAGGTAACACTTGCAGGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152657.3-969s21c1
Sequence:CCGGTGCCTCAGGTGCCATCTCTTACTCGAGTAAGAGATGGCACCTGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152657.3-586s21c1
Sequence:CCGGCTATCCGTGAAGGACACTGTCCTCGAGGACAGTGTCCTTCACGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152657.3-874s21c1
Sequence:CCGGTTCAAGTCGAGGCCCTCTTTGCTCGAGCAAAGAGGGCCTCGACTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks