EMAIL THIS PAGE TO A FRIEND

GGNBP1

gametogenetin binding protein 1 (pseudogene)

92 Gene Product Result for
UniProtKB ID: Q5YKI7, Q5YKI8
Gene ID:
Mouse(70772) gametogenetin binding protein 1
Rat(494520) gametogenetin binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027544 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027544 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027544 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001721177 Rosetta Predictions human pricing
XM_001721178 Rosetta Predictions human pricing
XM_001721286 Rosetta Predictions human pricing
XM_001721288 Rosetta Predictions human pricing
XM_001724454 Rosetta Predictions human pricing
XM_001724455 Rosetta Predictions human pricing
NM_001009972 Rosetta Predictions rat pricing
NM_027544 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00441311 predicted 633
2 SASI_Hs02_00441312 predicted 666
3 SASI_Hs02_00441313 predicted 652
4 SASI_Hs02_00441314 predicted 633
5 SASI_Hs02_00441315 predicted 634
6 SASI_Hs02_00441316 predicted 634
7 SASI_Hs02_00441317 predicted 652
8 SASI_Hs02_00441318 predicted 700
9 SASI_Hs02_00441319 predicted 687
10 SASI_Hs02_00441320 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00441321 predicted 696
2 SASI_Hs02_00441322 predicted 642
3 SASI_Hs02_00441323 predicted 685
4 SASI_Hs02_00441324 predicted 659
5 SASI_Hs02_00441325 predicted 657
6 SASI_Hs02_00441326 predicted 678
7 SASI_Hs02_00441327 predicted 714
8 SASI_Hs02_00441328 predicted 675
9 SASI_Hs02_00441329 predicted 636
10 SASI_Hs02_00441330 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00441959 predicted 641
2 SASI_Hs02_00441960 predicted 663
3 SASI_Hs02_00441961 predicted 654
4 SASI_Hs02_00441962 predicted 633
5 SASI_Hs02_00441963 predicted 627
6 SASI_Hs02_00441964 predicted 631
7 SASI_Hs02_00441965 predicted 655
8 SASI_Hs02_00441966 predicted 701
9 SASI_Hs02_00441967 predicted 686
10 SASI_Hs02_00441968 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00441973 predicted 694
2 SASI_Hs02_00441974 predicted 639
3 SASI_Hs02_00441975 predicted 684
4 SASI_Hs02_00441976 predicted 662
5 SASI_Hs02_00441977 predicted 651
6 SASI_Hs02_00441978 predicted 675
7 SASI_Hs02_00441979 predicted 711
8 SASI_Hs02_00441980 predicted 671
9 SASI_Hs02_00441981 predicted 636
10 SASI_Hs02_00441982 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00461795 predicted 696
2 SASI_Hs02_00461796 predicted 640
3 SASI_Hs02_00461797 predicted 685
4 SASI_Hs02_00461798 predicted 660
5 SASI_Hs02_00461799 predicted 655
6 SASI_Hs02_00461800 predicted 711
7 SASI_Hs02_00461801 predicted 628
8 SASI_Hs02_00461802 predicted 682
9 SASI_Hs02_00461803 predicted 687
10 SASI_Hs02_00461804 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00461805 predicted 698
2 SASI_Hs02_00461806 predicted 639
3 SASI_Hs02_00461807 predicted 686
4 SASI_Hs02_00461808 predicted 875
5 SASI_Hs02_00461809 predicted 857
6 SASI_Hs02_00461810 predicted 876
7 SASI_Hs02_00461811 predicted 659
8 SASI_Hs02_00461812 predicted 656
9 SASI_Hs02_00461813 predicted 712
10 SASI_Hs02_00461814 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089531 predicted 432
2 SASI_Rn01_00089532 predicted 272
3 SASI_Rn01_00089534 predicted 277
4 SASI_Rn01_00089535 predicted 837
5 SASI_Rn01_00089536 predicted 786
6 SASI_Rn01_00089537 predicted 649
7 SASI_Rn01_00089538 predicted 380
8 SASI_Rn01_00089539 predicted 752
9 SASI_Rn02_00199806 predicted 645
10 SASI_Rn02_00199807 predicted 335
11 SASI_Rn01_00089533 predicted 235
12 SASI_Rn01_00089540 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027544 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332387 predicted 563
2 SASI_Mm01_00050055 predicted 484
3 SASI_Mm01_00050056 predicted 922
4 SASI_Mm01_00050057 predicted 1099
5 SASI_Mm01_00050058 predicted 281
6 SASI_Mm02_00332388 predicted 791
7 SASI_Mm01_00050060 predicted 723
8 SASI_Mm01_00050061 predicted 543
9 SASI_Mm02_00332389 predicted 869
10 SASI_Mm01_00050062 predicted 1062
11 SASI_Mm01_00050053 predicted 813
12 SASI_Mm01_00050054 predicted 804
13 SASI_Mm01_00050059 predicted 1237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027544
GGNBP1 MISSION shRNA Bacterial Glycerol Stock
gametogenetin binding protein 1 (pseudogene)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027544.1-720s1c1
Sequence:CCGGCAAGGATGCTTACAGTGGGTTCTCGAGAACCCACTGTAAGCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027544.1-711s1c1
Sequence:CCGGGAGACAGAACAAGGATGCTTACTCGAGTAAGCATCCTTGTTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027544.1-853s1c1
Sequence:CCGGCGTGGAATTATCTCCTTGGCTCTCGAGAGCCAAGGAGATAATTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027544.2-545s21c1
Sequence:CCGGCAAGGATGTCCCGAAGCTAAGCTCGAGCTTAGCTTCGGGACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027544.2-787s21c1
Sequence:CCGGAGGATGAACACTGCCCAATTGCTCGAGCAATTGGGCAGTGTTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027544.2-252s21c1
Sequence:CCGGATGCTGCGCTTTCTCCGAAACCTCGAGGTTTCGGAGAAAGCGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027544.2-288s21c1
Sequence:CCGGGGCGGTTCTAAGAGCACTAACCTCGAGGTTAGTGCTCTTAGAACCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027544.2-1094s21c1
Sequence:CCGGGAAGTTTAGGTCTACAGATACCTCGAGGTATCTGTAGACCTAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027544
GGNBP1 MISSION shRNA shRNA Plasmid DNA
gametogenetin binding protein 1 (pseudogene)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027544.1-720s1c1
Sequence:CCGGCAAGGATGCTTACAGTGGGTTCTCGAGAACCCACTGTAAGCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027544.1-711s1c1
Sequence:CCGGGAGACAGAACAAGGATGCTTACTCGAGTAAGCATCCTTGTTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027544.1-853s1c1
Sequence:CCGGCGTGGAATTATCTCCTTGGCTCTCGAGAGCCAAGGAGATAATTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027544.2-545s21c1
Sequence:CCGGCAAGGATGTCCCGAAGCTAAGCTCGAGCTTAGCTTCGGGACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027544.2-787s21c1
Sequence:CCGGAGGATGAACACTGCCCAATTGCTCGAGCAATTGGGCAGTGTTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027544.2-252s21c1
Sequence:CCGGATGCTGCGCTTTCTCCGAAACCTCGAGGTTTCGGAGAAAGCGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027544.2-288s21c1
Sequence:CCGGGGCGGTTCTAAGAGCACTAACCTCGAGGTTAGTGCTCTTAGAACCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027544.2-1094s21c1
Sequence:CCGGGAAGTTTAGGTCTACAGATACCTCGAGGTATCTGTAGACCTAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027544
GGNBP1 MISSION shRNA Lentiviral Transduction Particles
gametogenetin binding protein 1 (pseudogene)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027544.1-720s1c1
Sequence:CCGGCAAGGATGCTTACAGTGGGTTCTCGAGAACCCACTGTAAGCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027544.1-711s1c1
Sequence:CCGGGAGACAGAACAAGGATGCTTACTCGAGTAAGCATCCTTGTTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027544.1-853s1c1
Sequence:CCGGCGTGGAATTATCTCCTTGGCTCTCGAGAGCCAAGGAGATAATTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027544.2-545s21c1
Sequence:CCGGCAAGGATGTCCCGAAGCTAAGCTCGAGCTTAGCTTCGGGACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027544.2-787s21c1
Sequence:CCGGAGGATGAACACTGCCCAATTGCTCGAGCAATTGGGCAGTGTTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027544.2-252s21c1
Sequence:CCGGATGCTGCGCTTTCTCCGAAACCTCGAGGTTTCGGAGAAAGCGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027544.2-288s21c1
Sequence:CCGGGGCGGTTCTAAGAGCACTAACCTCGAGGTTAGTGCTCTTAGAACCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027544.2-1094s21c1
Sequence:CCGGGAAGTTTAGGTCTACAGATACCTCGAGGTATCTGTAGACCTAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks