EMAIL THIS PAGE TO A FRIEND

GGNBP2

gametogenetin binding protein 2

142 Gene Product Result for
Synonyms: DIF-3 DIF3 LCRG1 LZK1 ZFP403 ZNF403
UniProtKB ID: Q9H3C7, B2RPK7, Q96T90, Q9GZR8, Q9H767
Gene ID:
Mouse(217039) gametogenetin binding protein 2
Rat(360584) gametogenetin binding protein 2
sheep(101110774) gametogenetin binding protein 2
domestic guinea pig(100733223) gametogenetin binding protein 2
naked mole-rat(101703488) gametogenetin binding protein 2
Zebrafish(552967) gametogenetin binding protein 2
cow(539076) gametogenetin binding protein 2
Horse(100057558) gametogenetin binding protein 2
domestic cat(101083982) gametogenetin binding protein 2
dog(480594) gametogenetin binding protein 2
chicken(425053) gametogenetin binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153144 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153144 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153144 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024835 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024835 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024835 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU205231 MISSION® esiRNA esiRNA targeting mouse Ggnbp2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024835 Rosetta Predictions human pricing
NM_001004273 Rosetta Predictions rat pricing
XM_001081060 Rosetta Predictions rat pricing
XM_001081065 Rosetta Predictions rat pricing
XM_579133 Rosetta Predictions rat pricing
NM_153144 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131267 predicted 790
2 SASI_Hs01_00131268 predicted 1282
3 SASI_Hs01_00131269 predicted 964
4 SASI_Hs02_00357400 predicted 1036
5 SASI_Hs01_00131271 predicted 1459
6 SASI_Hs01_00131272 predicted 2202
7 SASI_Hs01_00131273 predicted 2285
8 SASI_Hs01_00131274 predicted 1227
9 SASI_Hs01_00131275 predicted 2190
10 SASI_Hs02_00357401 predicted 1305
11 SASI_Hs01_00131270 predicted 642
12 SASI_Hs01_00131276 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106247 predicted 400
2 SASI_Rn01_00106248 predicted 414
3 SASI_Rn01_00106250 predicted 724
4 SASI_Rn02_00198306 predicted 720
5 SASI_Rn01_00106251 predicted 2192
6 SASI_Rn01_00106252 predicted 957
7 SASI_Rn01_00106253 predicted 2189
8 SASI_Rn01_00106254 predicted 1298
9 SASI_Rn01_00106255 predicted 1023
10 SASI_Rn01_00106256 predicted 2143
11 SASI_Rn01_00106249 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081060 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370404 predicted 392
2 SASI_Rn02_00370405 predicted 377
3 SASI_Rn02_00370406 predicted 1984
4 SASI_Rn02_00370407 predicted 750
5 SASI_Rn02_00370408 predicted 1981
6 SASI_Rn02_00370409 predicted 1090
7 SASI_Rn02_00370410 predicted 815
8 SASI_Rn02_00370411 predicted 1943
9 SASI_Rn02_00370412 predicted 2169
10 SASI_Rn02_00370413 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081065 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370434 predicted 392
2 SASI_Rn02_00370435 predicted 378
3 SASI_Rn02_00370436 predicted 1852
4 SASI_Rn02_00370437 predicted 620
5 SASI_Rn02_00370438 predicted 1847
6 SASI_Rn02_00370439 predicted 957
7 SASI_Rn02_00370440 predicted 688
8 SASI_Rn02_00370441 predicted 1812
9 SASI_Rn02_00370442 predicted 2037
10 SASI_Rn02_00370443 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142851 predicted 410
2 SASI_Rn01_00142852 predicted 415
3 SASI_Rn01_00142853 predicted 1326
4 SASI_Rn01_00142854 predicted 729
5 SASI_Rn01_00142855 predicted 2200
6 SASI_Rn01_00142856 predicted 971
7 SASI_Rn01_00142857 predicted 2187
8 SASI_Rn01_00142858 predicted 1297
9 SASI_Rn01_00142859 predicted 1032
10 SASI_Rn01_00142860 predicted 2150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153144 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144957 predicted 1416
2 SASI_Mm01_00144958 predicted 691
3 SASI_Mm01_00144959 predicted 677
4 SASI_Mm01_00144960 predicted 2242
5 SASI_Mm01_00144961 predicted 2158
6 SASI_Mm01_00144962 predicted 925
7 SASI_Mm02_00343031 predicted 504
8 SASI_Mm01_00144964 predicted 1264
9 SASI_Mm01_00144965 predicted 983
10 SASI_Mm02_00343032 predicted 2342
11 SASI_Mm01_00144956 predicted 2449
12 SASI_Mm01_00144963 predicted 2289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153144
VALIDATED
GGNBP2 MISSION shRNA Bacterial Glycerol Stock
gametogenetin binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153144.2-1478s21c1
Sequence:CCGGGCGAGACTTGTGTAGAAGTAACTCGAGTTACTTCTACACAAGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153144.2-2314s21c1
Sequence:CCGGGCTCTGTCTTTCAATGAAACACTCGAGTGTTTCATTGAAAGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153144.2-2151s21c1
Sequence:CCGGACAGTCATTTATGGCTAATAACTCGAGTTATTAGCCATAAATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153144.2-1993s21c1
Sequence:CCGGCCTTGGTTTGAGCATAGGAAACTCGAGTTTCCTATGCTCAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153144.2-1068s21c1
Sequence:CCGGACATGCTAAGACAATAGATATCTCGAGATATCTATTGTCTTAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153144.1-2443s1c1
Sequence:CCGGGCTCTGTCTTTCAATGAAACACTCGAGTGTTTCATTGAAAGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153144.1-1607s1c1
Sequence:CCGGGCGAGACTTGTGTAGAAGTAACTCGAGTTACTTCTACACAAGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153144.1-1994s1c1
Sequence:CCGGGCTGTATTACAGATCCAGGTACTCGAGTACCTGGATCTGTAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153144.1-2122s1c1
Sequence:CCGGCCTTGGTTTGAGCATAGGAAACTCGAGTTTCCTATGCTCAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153144.1-355s1c1
Sequence:CCGGGCACAACTAAAGCAGTTTATTCTCGAGAATAAACTGCTTTAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153144
VALIDATED
GGNBP2 MISSION shRNA shRNA Plasmid DNA
gametogenetin binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153144.2-1478s21c1
Sequence:CCGGGCGAGACTTGTGTAGAAGTAACTCGAGTTACTTCTACACAAGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153144.2-2314s21c1
Sequence:CCGGGCTCTGTCTTTCAATGAAACACTCGAGTGTTTCATTGAAAGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153144.2-2151s21c1
Sequence:CCGGACAGTCATTTATGGCTAATAACTCGAGTTATTAGCCATAAATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153144.2-1993s21c1
Sequence:CCGGCCTTGGTTTGAGCATAGGAAACTCGAGTTTCCTATGCTCAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153144.2-1068s21c1
Sequence:CCGGACATGCTAAGACAATAGATATCTCGAGATATCTATTGTCTTAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153144.1-2443s1c1
Sequence:CCGGGCTCTGTCTTTCAATGAAACACTCGAGTGTTTCATTGAAAGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153144.1-1607s1c1
Sequence:CCGGGCGAGACTTGTGTAGAAGTAACTCGAGTTACTTCTACACAAGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153144.1-1994s1c1
Sequence:CCGGGCTGTATTACAGATCCAGGTACTCGAGTACCTGGATCTGTAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153144.1-2122s1c1
Sequence:CCGGCCTTGGTTTGAGCATAGGAAACTCGAGTTTCCTATGCTCAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153144.1-355s1c1
Sequence:CCGGGCACAACTAAAGCAGTTTATTCTCGAGAATAAACTGCTTTAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153144
VALIDATED
GGNBP2 MISSION shRNA Lentiviral Transduction Particles
gametogenetin binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153144.2-1478s21c1
Sequence:CCGGGCGAGACTTGTGTAGAAGTAACTCGAGTTACTTCTACACAAGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153144.2-2314s21c1
Sequence:CCGGGCTCTGTCTTTCAATGAAACACTCGAGTGTTTCATTGAAAGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153144.2-2151s21c1
Sequence:CCGGACAGTCATTTATGGCTAATAACTCGAGTTATTAGCCATAAATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153144.2-1993s21c1
Sequence:CCGGCCTTGGTTTGAGCATAGGAAACTCGAGTTTCCTATGCTCAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153144.2-1068s21c1
Sequence:CCGGACATGCTAAGACAATAGATATCTCGAGATATCTATTGTCTTAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153144.1-2443s1c1
Sequence:CCGGGCTCTGTCTTTCAATGAAACACTCGAGTGTTTCATTGAAAGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153144.1-1607s1c1
Sequence:CCGGGCGAGACTTGTGTAGAAGTAACTCGAGTTACTTCTACACAAGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153144.1-1994s1c1
Sequence:CCGGGCTGTATTACAGATCCAGGTACTCGAGTACCTGGATCTGTAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153144.1-2122s1c1
Sequence:CCGGCCTTGGTTTGAGCATAGGAAACTCGAGTTTCCTATGCTCAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153144.1-355s1c1
Sequence:CCGGGCACAACTAAAGCAGTTTATTCTCGAGAATAAACTGCTTTAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024835
VALIDATED
GGNBP2 MISSION shRNA Bacterial Glycerol Stock
gametogenetin binding protein 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024835.2-921s21c1
Sequence:CCGGCCGAGCATACAATATCCTTATCTCGAGATAAGGATATTGTATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024835.2-2479s21c1
Sequence:CCGGACGGTGGAGGTATCCTCATTACTCGAGTAATGAGGATACCTCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024835.2-2322s21c1
Sequence:CCGGGACAACGGCTGGAGCAAATTACTCGAGTAATTTGCTCCAGCCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024835.2-1107s21c1
Sequence:CCGGGCATGCAAAGACAATAGATATCTCGAGATATCTATTGTCTTTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024835.2-2193s21c1
Sequence:CCGGACAGTCATTTATGGCTAATAACTCGAGTTATTAGCCATAAATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024835.1-1221s1c1
Sequence:CCGGCCCTTACAAACAGCAGATGAACTCGAGTTCATCTGCTGTTTGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024835
VALIDATED
GGNBP2 MISSION shRNA shRNA Plasmid DNA
gametogenetin binding protein 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024835.2-921s21c1
Sequence:CCGGCCGAGCATACAATATCCTTATCTCGAGATAAGGATATTGTATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024835.2-2479s21c1
Sequence:CCGGACGGTGGAGGTATCCTCATTACTCGAGTAATGAGGATACCTCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024835.2-2322s21c1
Sequence:CCGGGACAACGGCTGGAGCAAATTACTCGAGTAATTTGCTCCAGCCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024835.2-1107s21c1
Sequence:CCGGGCATGCAAAGACAATAGATATCTCGAGATATCTATTGTCTTTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024835.2-2193s21c1
Sequence:CCGGACAGTCATTTATGGCTAATAACTCGAGTTATTAGCCATAAATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024835.1-1221s1c1
Sequence:CCGGCCCTTACAAACAGCAGATGAACTCGAGTTCATCTGCTGTTTGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024835
VALIDATED
GGNBP2 MISSION shRNA Lentiviral Transduction Particles
gametogenetin binding protein 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024835.2-921s21c1
Sequence:CCGGCCGAGCATACAATATCCTTATCTCGAGATAAGGATATTGTATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024835.2-2479s21c1
Sequence:CCGGACGGTGGAGGTATCCTCATTACTCGAGTAATGAGGATACCTCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024835.2-2322s21c1
Sequence:CCGGGACAACGGCTGGAGCAAATTACTCGAGTAATTTGCTCCAGCCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024835.2-1107s21c1
Sequence:CCGGGCATGCAAAGACAATAGATATCTCGAGATATCTATTGTCTTTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024835.2-2193s21c1
Sequence:CCGGACAGTCATTTATGGCTAATAACTCGAGTTATTAGCCATAAATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024835.1-1221s1c1
Sequence:CCGGCCCTTACAAACAGCAGATGAACTCGAGTTCATCTGCTGTTTGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks