EMAIL THIS PAGE TO A FRIEND

GGPS1

geranylgeranyl diphosphate synthase 1

134 Gene Product Result for
Synonyms: GGPPS GGPPS1
UniProtKB ID: O95749, Q5T2C8, Q6NW19
Gene ID:
Human(9453) Summary: This gene is a member of the prenyltransferase family and encodes a protein with geranylgeranyl diphosphate (GGPP) synthase activity. The enzyme catalyzes the synthesis of GGPP from farnesyl diphosphate and isopentenyl diphosphate. GGPP is an important molecule responsible for the C20-prenylation of proteins and for the regulation of a nuclear hormone receptor. Alternate transcriptional splice variants, both protein-coding and non-protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
Mouse(14593) geranylgeranyl diphosphate synthase 1
Rat(291211) geranylgeranyl diphosphate synthase 1
Zebrafish(336798) geranylgeranyl diphosphate synthase 1
cow(780882) geranylgeranyl diphosphate synthase 1
domestic cat(101082438) geranylgeranyl diphosphate synthase 1
dog(479198) geranylgeranyl diphosphate synthase 1
Thale Cress(829834) geranylgeranyl pyrophosphate synthase 1
chicken(427092) geranylgeranyl diphosphate synthase 1
naked mole-rat(101698516) geranylgeranyl diphosphate synthase 1
domestic guinea pig(100720358) geranylgeranyl diphosphate synthase 1
sheep(101114414) geranylgeranyl diphosphate synthase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004837 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004837 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004837 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010282 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010282 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010282 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037277 Rosetta Predictions human pricing
NM_001037278 Rosetta Predictions human pricing
NM_004837 Rosetta Predictions human pricing
NM_001007626 Rosetta Predictions rat pricing
NM_010282 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179510 predicted 565
2 SASI_Hs01_00179511 predicted 1251
3 SASI_Hs01_00179512 predicted 1241
4 SASI_Hs01_00179513 predicted 1244
5 SASI_Hs01_00179515 predicted 706
6 SASI_Hs01_00179516 predicted 700
7 SASI_Hs01_00179517 predicted 769
8 SASI_Hs01_00179518 predicted 612
9 SASI_Hs01_00179519 predicted 709
10 SASI_Hs02_00308249 predicted 646
11 SASI_Hs01_00179514 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027296 predicted 642
2 SASI_Hs01_00027298 predicted 782
3 SASI_Hs01_00027299 predicted 771
4 SASI_Hs01_00027300 predicted 842
5 SASI_Hs01_00027301 predicted 680
6 SASI_Hs01_00027302 predicted 784
7 SASI_Hs01_00027303 predicted 725
8 SASI_Hs01_00027304 predicted 523
9 SASI_Hs01_00027305 predicted 517
10 SASI_Hs02_00308250 predicted 610
11 SASI_Hs01_00027297 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029328 predicted 733
2 SASI_Hs01_00029329 predicted 1418
3 SASI_Hs01_00029330 predicted 1398
4 SASI_Hs01_00029331 predicted 1409
5 SASI_Hs01_00029333 predicted 875
6 SASI_Hs01_00029334 predicted 867
7 SASI_Hs01_00029335 predicted 936
8 SASI_Hs01_00029336 predicted 773
9 SASI_Hs01_00029337 predicted 869
10 SASI_Hs02_00338412 predicted 811
11 SASI_Hs01_00029332 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198719 predicted 423
2 SASI_Rn02_00198720 predicted 283
3 SASI_Rn02_00198721 predicted 629
4 SASI_Rn02_00198722 predicted 504
5 SASI_Rn02_00198723 predicted 371
6 SASI_Rn02_00198724 predicted 380
7 SASI_Rn02_00198725 predicted 266
8 SASI_Rn02_00198726 predicted 410
9 SASI_Rn02_00198727 predicted 340
10 SASI_Rn02_00198728 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010282 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318221 predicted 392
2 SASI_Mm02_00318222 predicted 303
3 SASI_Mm02_00318223 predicted 476
4 SASI_Mm02_00318224 predicted 618
5 SASI_Mm02_00318225 predicted 349
6 SASI_Mm02_00318226 predicted 353
7 SASI_Mm02_00318227 predicted 262
8 SASI_Mm02_00318228 predicted 454
9 SASI_Mm01_00075488 predicted 234
10 SASI_Mm02_00318229 predicted 600
11 SASI_Mm01_00075487 predicted 253
12 SASI_Mm01_00075489 predicted 252
13 SASI_Mm01_00075490 predicted 684
14 SASI_Mm01_00075491 predicted 1132
15 SASI_Mm01_00075492 predicted 1126
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004837
VALIDATED
GGPS1 MISSION shRNA Bacterial Glycerol Stock
geranylgeranyl diphosphate synthase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004837.2-1076s1c1
Sequence:CCGGCCTGAGCTAGTAGCCTTAGTACTCGAGTACTAAGGCTACTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004837.2-1030s1c1
Sequence:CCGGGCTTGAAGCTAAAGCCTATAACTCGAGTTATAGGCTTTAGCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004837.2-332s1c1
Sequence:CCGGGCATTTAATCATTGGCTGAAACTCGAGTTTCAGCCAATGATTAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_004837.2-386s1c1
Sequence:CCGGGTGACAGAAATGTTGCATAATCTCGAGATTATGCAACATTTCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_004837.2-974s1c1
Sequence:CCGGGTACATTATCTTGAGGATGTACTCGAGTACATCCTCAAGATAATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004837.3-279s21c1
Sequence:CCGGATTCTTCTAGAACCCTATAAACTCGAGTTTATAGGGTTCTAGAAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004837.3-1240s21c1
Sequence:CCGGTATTCTCCAGAAACAGTAAATCTCGAGATTTACTGTTTCTGGAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004837.3-892s21c1
Sequence:CCGGTTCCTACTATTCATGCTATTTCTCGAGAAATAGCATGAATAGTAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004837.3-425s21c1
Sequence:CCGGCAGTTTACTCATCGATGATATCTCGAGATATCATCGATGAGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004837.3-1023s21c1
Sequence:CCGGTACACTCGTAATACCCTTAAACTCGAGTTTAAGGGTATTACGAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004837.3-636s21c1
Sequence:CCGGATTTACTGGAGGGATAATTACCTCGAGGTAATTATCCCTCCAGTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004837.3-1168s21c1
Sequence:CCGGATTGGACCTCATAGCTTATTTCTCGAGAAATAAGCTATGAGGTCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004837
VALIDATED
GGPS1 MISSION shRNA shRNA Plasmid DNA
geranylgeranyl diphosphate synthase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004837.2-1076s1c1
Sequence:CCGGCCTGAGCTAGTAGCCTTAGTACTCGAGTACTAAGGCTACTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004837.2-1030s1c1
Sequence:CCGGGCTTGAAGCTAAAGCCTATAACTCGAGTTATAGGCTTTAGCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004837.2-332s1c1
Sequence:CCGGGCATTTAATCATTGGCTGAAACTCGAGTTTCAGCCAATGATTAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_004837.2-386s1c1
Sequence:CCGGGTGACAGAAATGTTGCATAATCTCGAGATTATGCAACATTTCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_004837.2-974s1c1
Sequence:CCGGGTACATTATCTTGAGGATGTACTCGAGTACATCCTCAAGATAATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004837.3-279s21c1
Sequence:CCGGATTCTTCTAGAACCCTATAAACTCGAGTTTATAGGGTTCTAGAAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004837.3-1240s21c1
Sequence:CCGGTATTCTCCAGAAACAGTAAATCTCGAGATTTACTGTTTCTGGAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004837.3-892s21c1
Sequence:CCGGTTCCTACTATTCATGCTATTTCTCGAGAAATAGCATGAATAGTAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004837.3-425s21c1
Sequence:CCGGCAGTTTACTCATCGATGATATCTCGAGATATCATCGATGAGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004837.3-1023s21c1
Sequence:CCGGTACACTCGTAATACCCTTAAACTCGAGTTTAAGGGTATTACGAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004837.3-636s21c1
Sequence:CCGGATTTACTGGAGGGATAATTACCTCGAGGTAATTATCCCTCCAGTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004837.3-1168s21c1
Sequence:CCGGATTGGACCTCATAGCTTATTTCTCGAGAAATAAGCTATGAGGTCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004837
VALIDATED
GGPS1 MISSION shRNA Lentiviral Transduction Particles
geranylgeranyl diphosphate synthase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004837.2-1076s1c1
Sequence:CCGGCCTGAGCTAGTAGCCTTAGTACTCGAGTACTAAGGCTACTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004837.2-1030s1c1
Sequence:CCGGGCTTGAAGCTAAAGCCTATAACTCGAGTTATAGGCTTTAGCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004837.2-332s1c1
Sequence:CCGGGCATTTAATCATTGGCTGAAACTCGAGTTTCAGCCAATGATTAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_004837.2-386s1c1
Sequence:CCGGGTGACAGAAATGTTGCATAATCTCGAGATTATGCAACATTTCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_004837.2-974s1c1
Sequence:CCGGGTACATTATCTTGAGGATGTACTCGAGTACATCCTCAAGATAATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004837.3-279s21c1
Sequence:CCGGATTCTTCTAGAACCCTATAAACTCGAGTTTATAGGGTTCTAGAAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004837.3-1240s21c1
Sequence:CCGGTATTCTCCAGAAACAGTAAATCTCGAGATTTACTGTTTCTGGAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004837.3-892s21c1
Sequence:CCGGTTCCTACTATTCATGCTATTTCTCGAGAAATAGCATGAATAGTAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004837.3-425s21c1
Sequence:CCGGCAGTTTACTCATCGATGATATCTCGAGATATCATCGATGAGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004837.3-1023s21c1
Sequence:CCGGTACACTCGTAATACCCTTAAACTCGAGTTTAAGGGTATTACGAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004837.3-636s21c1
Sequence:CCGGATTTACTGGAGGGATAATTACCTCGAGGTAATTATCCCTCCAGTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004837.3-1168s21c1
Sequence:CCGGATTGGACCTCATAGCTTATTTCTCGAGAAATAAGCTATGAGGTCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010282
VALIDATED
GGPS1 MISSION shRNA Bacterial Glycerol Stock
geranylgeranyl diphosphate synthase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010282.1-282s1c1
Sequence:CCGGGCCAGTTTACTCATTGATGATCTCGAGATCATCAATGAGTAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010282.1-381s1c1
Sequence:CCGGGCCAATTACGTCTACTTCCTTCTCGAGAAGGAAGTAGACGTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010282.1-810s1c1
Sequence:CCGGCGCCAGAGAACAGAGAATATACTCGAGTATATTCTCTGTTCTCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010282.1-596s1c1
Sequence:CCGGGCAGCTGTTCTCTGATTACAACTCGAGTTGTAATCAGAGAACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010282.1-193s1c2
Sequence:CCGGGCAAACTTTCACAGGCATTTACTCGAGTAAATGCCTGTGAAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010282
VALIDATED
GGPS1 MISSION shRNA shRNA Plasmid DNA
geranylgeranyl diphosphate synthase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010282.1-282s1c1
Sequence:CCGGGCCAGTTTACTCATTGATGATCTCGAGATCATCAATGAGTAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010282.1-381s1c1
Sequence:CCGGGCCAATTACGTCTACTTCCTTCTCGAGAAGGAAGTAGACGTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010282.1-810s1c1
Sequence:CCGGCGCCAGAGAACAGAGAATATACTCGAGTATATTCTCTGTTCTCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010282.1-596s1c1
Sequence:CCGGGCAGCTGTTCTCTGATTACAACTCGAGTTGTAATCAGAGAACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010282.1-193s1c2
Sequence:CCGGGCAAACTTTCACAGGCATTTACTCGAGTAAATGCCTGTGAAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010282
VALIDATED
GGPS1 MISSION shRNA Lentiviral Transduction Particles
geranylgeranyl diphosphate synthase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010282.1-282s1c1
Sequence:CCGGGCCAGTTTACTCATTGATGATCTCGAGATCATCAATGAGTAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010282.1-381s1c1
Sequence:CCGGGCCAATTACGTCTACTTCCTTCTCGAGAAGGAAGTAGACGTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010282.1-810s1c1
Sequence:CCGGCGCCAGAGAACAGAGAATATACTCGAGTATATTCTCTGTTCTCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010282.1-596s1c1
Sequence:CCGGGCAGCTGTTCTCTGATTACAACTCGAGTTGTAATCAGAGAACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010282.1-193s1c2
Sequence:CCGGGCAAACTTTCACAGGCATTTACTCGAGTAAATGCCTGTGAAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks