EMAIL THIS PAGE TO A FRIEND

GGT1

gamma-glutamyltransferase 1

88 Gene Product Result for
Synonyms: CD224 D22S672 D22S732 GGT GGT 1 GTG
UniProtKB ID: P19440, Q08247, Q14404, Q8TBS1, Q9UMK1
Gene ID:
Human(2678) Summary: The enzyme encoded by this gene catalyzes the transfer of the glutamyl moiety of glutathione to a variety of amino acids and dipeptide acceptors. The enzyme is composed of a heavy chain and a light chain, which are derived from a single precursor protein, and is present in tissues involved in absorption and secretion. This enzyme is a member of the gamma-glutamyltransferase protein family, of which many members have not yet been fully characterized and some of which may represent pseudogenes. This gene is classified as type I gamma-glutamyltransferase. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Oct 2008]
Mouse(14598) gamma-glutamyltransferase 1
Rat(116568) gamma-glutamyltransferase 1
Thale Cress(830118) gamma-glutamyl transpeptidase 1
dog(486400) gamma-glutamyltransferase 1
domestic cat(101081761) gamma-glutamyltransferase 1
cow(615582) gamma-glutamyltransferase 1
Horse(100050188) gamma-glutamyltransferase 1
chicken(416945) gamma-glutamyltransferase 1
Thale Cress(838940) glutamate:glyoxylate aminotransferase
domestic guinea pig(100717316) gamma-glutamyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
150703 Acetamide zone-refined, purified by sublimation, 99% rat pricing
00160 Acetamide ≥99.0% (GC) rat pricing
A0500 Acetamide ~99% (GC) rat pricing
75434 Acetamide ≥98.0% (GC) rat pricing
19240 Butyramide ≥98.0% (T) rat pricing
G3126 L-Glutamine ReagentPlus®, ≥99% (HPLC) rat pricing
G5792 L-Glutamine PharmaGrade, Ajinomoto, USP, Manufactured under appropriate GMP controls for pharma or biopharmaceutical production, suitable for cell culture rat pricing
G8540 L-Glutamine meets USP testing specifications, cell culture tested, 99.0-101.0%, from non-animal source rat pricing
G6392 L-Glutamine γ-irradiated, BioXtra, suitable for cell culture rat pricing
49419 L-Glutamine BioUltra, ≥99.5% (NT) rat pricing
G7513 L-Glutamine solution 200 mM, solution, sterile-filtered, BioXtra, suitable for cell culture rat pricing
G2150 L-Glutamine solution 200 mM, Hybri-Max, sterile-filtered, suitable for hybridoma rat pricing
M9625 L-Methionine reagent grade, ≥98% (HPLC) rat pricing
M5308 L-Methionine from non-animal source, meets EP, JP, USP testing specifications, suitable for cell culture, 99.0-101.0% rat pricing
M8439 L-Methionine PharmaGrade, Ajinomoto, EP, JP, USP, manufactured under appropriate GMP controls for Pharma or Biopharmaceutical production, suitable for cell culture rat pricing
64319 L-Methionine BioUltra, ≥99.5% (NT) rat pricing
M0876 L-Methionine sulfone rat pricing
M1126 L-Methionine sulfoxide rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005265 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008116 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008116 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008116 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU041101 MISSION® esiRNA esiRNA targeting mouse Ggt1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032364 Rosetta Predictions human pricing
NM_001032365 Rosetta Predictions human pricing
NM_005265 Rosetta Predictions human pricing
NM_013430 Rosetta Predictions human pricing
NM_053840 Rosetta Predictions rat pricing
NM_008116 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307900 predicted 987
2 SASI_Hs02_00307901 predicted 991
3 SASI_Hs02_00307902 predicted 1065
4 SASI_Hs01_00203815 predicted 2121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307903 predicted 1034
2 SASI_Hs02_00307904 predicted 1035
3 SASI_Hs02_00307905 predicted 1111
4 SASI_Hs01_00084809 predicted 2167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339301 predicted 1094
2 SASI_Hs02_00339302 predicted 1102
3 SASI_Hs02_00339303 predicted 1179
4 SASI_Hs01_00099741 predicted 2236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344817 predicted 1046
2 SASI_Hs02_00344818 predicted 1050
3 SASI_Hs02_00344819 predicted 1132
4 SASI_Hs01_00190156 predicted 2182
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053840 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266687 predicted 416
2 SASI_Rn01_00096723 predicted 808
3 SASI_Rn02_00266688 predicted 1284
4 SASI_Rn01_00096725 predicted 607
5 SASI_Rn01_00096726 predicted 1071
6 SASI_Rn01_00096727 predicted 1046
7 SASI_Rn01_00096729 predicted 820
8 SASI_Rn01_00096728 predicted 533
9 SASI_Rn02_00266689 predicted 499
10 SASI_Rn01_00096730 predicted 1718
11 SASI_Rn01_00096724 predicted 1397
12 SASI_Rn01_00096731 predicted 519
13 SASI_Rn01_00096732 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179901 predicted 1034
2 SASI_Mm01_00179902 predicted 305
3 SASI_Mm01_00179903 predicted 1338
4 SASI_Mm01_00179904 predicted 218
5 SASI_Mm02_00313177 predicted 1403
6 SASI_Mm01_00179905 predicted 1433
7 SASI_Mm01_00179907 predicted 1248
8 SASI_Mm01_00179908 predicted 491
9 SASI_Mm01_00179909 predicted 677
10 SASI_Mm01_00179910 predicted 1179
11 SASI_Mm01_00179906 predicted 576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005265
VALIDATED
GGT1 MISSION shRNA Bacterial Glycerol Stock
gamma-glutamyltransferase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005265.2-2259s21c1
Sequence:CCGGGGACAAGGCTGACAAGCAATCCTCGAGGATTGCTTGTCAGCCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005265.2-1400s21c1
Sequence:CCGGTCATCCTCAACATCCTCAAAGCTCGAGCTTTGAGGATGTTGAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005265.2-801s21c1
Sequence:CCGGCCTCTTCCTCACCATCTACAACTCGAGTTGTAGATGGTGAGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005265.2-1816s21c1
Sequence:CCGGCCCAGCATCACCAACGAGTTTCTCGAGAAACTCGTTGGTGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005265.1-637s1c1
Sequence:CCGGCTACAACAGCACCACACGAAACTCGAGTTTCGTGTGGTGCTGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005265.1-506s1c1
Sequence:CCGGTGCTCGAAGATTGGGAGGGATCTCGAGATCCCTCCCAATCTTCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005265.1-622s1c1
Sequence:CCGGCCTCTTCCTCACCATCTACAACTCGAGTTGTAGATGGTGAGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005265.1-1609s1c1
Sequence:CCGGCAATAATGAAATGGACGACTTCTCGAGAAGTCGTCCATTTCATTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005265.1-1637s1c1
Sequence:CCGGCCCAGCATCACCAACGAGTTTCTCGAGAAACTCGTTGGTGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005265
VALIDATED
GGT1 MISSION shRNA shRNA Plasmid DNA
gamma-glutamyltransferase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005265.2-2259s21c1
Sequence:CCGGGGACAAGGCTGACAAGCAATCCTCGAGGATTGCTTGTCAGCCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005265.2-1400s21c1
Sequence:CCGGTCATCCTCAACATCCTCAAAGCTCGAGCTTTGAGGATGTTGAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005265.2-801s21c1
Sequence:CCGGCCTCTTCCTCACCATCTACAACTCGAGTTGTAGATGGTGAGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005265.2-1816s21c1
Sequence:CCGGCCCAGCATCACCAACGAGTTTCTCGAGAAACTCGTTGGTGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005265.1-637s1c1
Sequence:CCGGCTACAACAGCACCACACGAAACTCGAGTTTCGTGTGGTGCTGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005265.1-506s1c1
Sequence:CCGGTGCTCGAAGATTGGGAGGGATCTCGAGATCCCTCCCAATCTTCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005265.1-622s1c1
Sequence:CCGGCCTCTTCCTCACCATCTACAACTCGAGTTGTAGATGGTGAGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005265.1-1609s1c1
Sequence:CCGGCAATAATGAAATGGACGACTTCTCGAGAAGTCGTCCATTTCATTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005265.1-1637s1c1
Sequence:CCGGCCCAGCATCACCAACGAGTTTCTCGAGAAACTCGTTGGTGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005265
VALIDATED
GGT1 MISSION shRNA Lentiviral Transduction Particles
gamma-glutamyltransferase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005265.2-2259s21c1
Sequence:CCGGGGACAAGGCTGACAAGCAATCCTCGAGGATTGCTTGTCAGCCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005265.2-1400s21c1
Sequence:CCGGTCATCCTCAACATCCTCAAAGCTCGAGCTTTGAGGATGTTGAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005265.2-801s21c1
Sequence:CCGGCCTCTTCCTCACCATCTACAACTCGAGTTGTAGATGGTGAGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005265.2-1816s21c1
Sequence:CCGGCCCAGCATCACCAACGAGTTTCTCGAGAAACTCGTTGGTGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005265.1-637s1c1
Sequence:CCGGCTACAACAGCACCACACGAAACTCGAGTTTCGTGTGGTGCTGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005265.1-506s1c1
Sequence:CCGGTGCTCGAAGATTGGGAGGGATCTCGAGATCCCTCCCAATCTTCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005265.1-622s1c1
Sequence:CCGGCCTCTTCCTCACCATCTACAACTCGAGTTGTAGATGGTGAGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005265.1-1609s1c1
Sequence:CCGGCAATAATGAAATGGACGACTTCTCGAGAAGTCGTCCATTTCATTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005265.1-1637s1c1
Sequence:CCGGCCCAGCATCACCAACGAGTTTCTCGAGAAACTCGTTGGTGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008116
VALIDATED
GGT1 MISSION shRNA Bacterial Glycerol Stock
gamma-glutamyltransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008116.1-1435s1c1
Sequence:CCGGGCCCAACTTCATCAACCAGTTCTCGAGAACTGGTTGATGAAGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008116.1-1255s1c1
Sequence:CCGGCGCCTACTATGAGCCTGAATTCTCGAGAATTCAGGCTCATAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008116.1-306s1c1
Sequence:CCGGGCTCAGAGATTGGACGGGATACTCGAGTATCCCGTCCAATCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008116.1-1519s1c1
Sequence:CCGGTCCCTCAATCATCCTGGATAACTCGAGTTATCCAGGATGATTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008116.1-1012s1c1
Sequence:CCGGGCTGATTCTCATCTTGAACATCTCGAGATGTTCAAGATGAGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008116
VALIDATED
GGT1 MISSION shRNA shRNA Plasmid DNA
gamma-glutamyltransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008116.1-1435s1c1
Sequence:CCGGGCCCAACTTCATCAACCAGTTCTCGAGAACTGGTTGATGAAGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008116.1-1255s1c1
Sequence:CCGGCGCCTACTATGAGCCTGAATTCTCGAGAATTCAGGCTCATAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008116.1-306s1c1
Sequence:CCGGGCTCAGAGATTGGACGGGATACTCGAGTATCCCGTCCAATCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008116.1-1519s1c1
Sequence:CCGGTCCCTCAATCATCCTGGATAACTCGAGTTATCCAGGATGATTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008116.1-1012s1c1
Sequence:CCGGGCTGATTCTCATCTTGAACATCTCGAGATGTTCAAGATGAGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008116
VALIDATED
GGT1 MISSION shRNA Lentiviral Transduction Particles
gamma-glutamyltransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008116.1-1435s1c1
Sequence:CCGGGCCCAACTTCATCAACCAGTTCTCGAGAACTGGTTGATGAAGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008116.1-1255s1c1
Sequence:CCGGCGCCTACTATGAGCCTGAATTCTCGAGAATTCAGGCTCATAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008116.1-306s1c1
Sequence:CCGGGCTCAGAGATTGGACGGGATACTCGAGTATCCCGTCCAATCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008116.1-1519s1c1
Sequence:CCGGTCCCTCAATCATCCTGGATAACTCGAGTTATCCAGGATGATTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008116.1-1012s1c1
Sequence:CCGGGCTGATTCTCATCTTGAACATCTCGAGATGTTCAAGATGAGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks