EMAIL THIS PAGE TO A FRIEND

GGT5

gamma-glutamyltransferase 5

72 Gene Product Result for
Synonyms: GGT-REL GGTLA1
UniProtKB ID: P36269, Q53XM9, Q6GMP0, Q96FC1, Q9UFM5
Gene ID:
Human(2687) Summary: This gene is a member of a gene family that encodes gamma-glutamyl transpeptidase enzymes. This enzyme consists of a heavy and a light chain, and is able to hydrolyze the gamma-glutamyl moiety of glutathione. It converts leukotriene C4 to leukotriene D4, however, it doesn't convert synthetic substrates that are commonly used to assay gamma-glutamyl transpeptidase. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(23887) gamma-glutamyltransferase 5
Rat(29566) gamma-glutamyltransferase 5
chicken(416943) gamma-glutamyltransferase 5
dog(486401) gamma-glutamyltransferase 5
domestic cat(101082015) gamma-glutamyltransferase 5
cow(787326) gamma-glutamyltransferase 5
Horse(100050259) gamma-glutamyltransferase 5
domestic guinea pig(100714159) gamma-glutamyltransferase 5
naked mole-rat(101723554) gamma-glutamyltransferase 5
sheep(101112423) gamma-glutamyltransferase 5
Domestic Rabbit(100358051) gamma-glutamyltransferase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011820 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011820 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011820 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004121 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004121 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004121 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU029721 MISSION® esiRNA esiRNA targeting mouse Ggt5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099781 Rosetta Predictions human pricing
NM_001099782 Rosetta Predictions human pricing
NM_004121 Rosetta Predictions human pricing
NM_019235 Rosetta Predictions rat pricing
NM_011820 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321428 predicted 1353
2 SASI_Hs02_00321429 predicted 1273
3 SASI_Hs02_00321430 predicted 1359
4 SASI_Hs02_00321431 predicted 1310
5 SASI_Hs02_00321432 predicted 1300
6 SASI_Hs02_00321433 predicted 1289
7 SASI_Hs02_00321434 predicted 2166
8 SASI_Hs02_00321435 predicted 2249
9 SASI_Hs02_00321436 predicted 1321
10 SASI_Hs02_00321437 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321438 predicted 1266
2 SASI_Hs02_00321439 predicted 1210
3 SASI_Hs02_00321440 predicted 1211
4 SASI_Hs02_00321441 predicted 1204
5 SASI_Hs02_00321442 predicted 1198
6 SASI_Hs02_00321443 predicted 1249
7 SASI_Hs02_00321444 predicted 1195
8 SASI_Hs02_00321445 predicted 2074
9 SASI_Hs02_00321446 predicted 2151
10 SASI_Hs02_00321447 predicted 1950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012131 predicted 1359
2 SASI_Hs01_00012132 predicted 1273
3 SASI_Hs01_00012134 predicted 1359
4 SASI_Hs01_00012135 predicted 1310
5 SASI_Hs01_00012137 predicted 1300
6 SASI_Hs01_00012138 predicted 1289
7 SASI_Hs02_00336968 predicted 2162
8 SASI_Hs02_00336969 predicted 2250
9 SASI_Hs02_00336970 predicted 1315
10 SASI_Hs02_00336971 predicted 1280
11 SASI_Hs01_00012133 predicted 937
12 SASI_Hs01_00012136 predicted 630
13 SASI_Hs01_00012139 predicted 1458
14 SASI_Hs01_00012140 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087858 predicted 2030
2 SASI_Rn01_00087859 predicted 1128
3 SASI_Rn01_00087860 predicted 1954
4 SASI_Rn01_00087861 predicted 1805
5 SASI_Rn01_00087862 predicted 572
6 SASI_Rn02_00262101 predicted 635
7 SASI_Rn01_00087863 predicted 998
8 SASI_Rn01_00087865 predicted 1078
9 SASI_Rn02_00262102 predicted 1226
10 SASI_Rn01_00087866 predicted 1210
11 SASI_Rn01_00087864 predicted 1548
12 SASI_Rn01_00087867 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058298 predicted 1190
2 SASI_Mm01_00058299 predicted 946
3 SASI_Mm01_00058300 predicted 1618
4 SASI_Mm01_00058301 predicted 851
5 SASI_Mm01_00058302 predicted 1872
6 SASI_Mm02_00321525 predicted 2074
7 SASI_Mm01_00058303 predicted 848
8 SASI_Mm02_00321526 predicted 2092
9 SASI_Mm01_00058306 predicted 1274
10 SASI_Mm01_00058307 predicted 1191
11 SASI_Mm01_00058304 predicted 2104
12 SASI_Mm01_00058305 predicted 2088
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011820
GGT5 MISSION shRNA Bacterial Glycerol Stock
gamma-glutamyltransferase 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011820.2-1885s1c1
Sequence:CCGGCCCAAATTCAACCAGGAGGTACTCGAGTACCTCCTGGTTGAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011820.2-867s1c1
Sequence:CCGGCCTCAGCCAATTCCTCAACAACTCGAGTTGTTGAGGAATTGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011820.2-1293s1c1
Sequence:CCGGCCTTGTAGAGACTCTCAAGTTCTCGAGAACTTGAGAGTCTCTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011820.2-1702s1c1
Sequence:CCGGCCTTCCATCTTGGTCAACAAACTCGAGTTTGTTGACCAAGATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011820.2-374s1c1
Sequence:CCGGGTGTAGGTCTAGGTCTGGTTACTCGAGTAACCAGACCTAGACCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011820
GGT5 MISSION shRNA shRNA Plasmid DNA
gamma-glutamyltransferase 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011820.2-1885s1c1
Sequence:CCGGCCCAAATTCAACCAGGAGGTACTCGAGTACCTCCTGGTTGAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011820.2-867s1c1
Sequence:CCGGCCTCAGCCAATTCCTCAACAACTCGAGTTGTTGAGGAATTGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011820.2-1293s1c1
Sequence:CCGGCCTTGTAGAGACTCTCAAGTTCTCGAGAACTTGAGAGTCTCTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011820.2-1702s1c1
Sequence:CCGGCCTTCCATCTTGGTCAACAAACTCGAGTTTGTTGACCAAGATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011820.2-374s1c1
Sequence:CCGGGTGTAGGTCTAGGTCTGGTTACTCGAGTAACCAGACCTAGACCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011820
GGT5 MISSION shRNA Lentiviral Transduction Particles
gamma-glutamyltransferase 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011820.2-1885s1c1
Sequence:CCGGCCCAAATTCAACCAGGAGGTACTCGAGTACCTCCTGGTTGAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011820.2-867s1c1
Sequence:CCGGCCTCAGCCAATTCCTCAACAACTCGAGTTGTTGAGGAATTGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011820.2-1293s1c1
Sequence:CCGGCCTTGTAGAGACTCTCAAGTTCTCGAGAACTTGAGAGTCTCTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011820.2-1702s1c1
Sequence:CCGGCCTTCCATCTTGGTCAACAAACTCGAGTTTGTTGACCAAGATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011820.2-374s1c1
Sequence:CCGGGTGTAGGTCTAGGTCTGGTTACTCGAGTAACCAGACCTAGACCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004121
GGT5 MISSION shRNA Bacterial Glycerol Stock
gamma-glutamyltransferase 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004121.1-1247s1c1
Sequence:CCGGCAACTTCTCAACAGAGTCTATCTCGAGATAGACTCTGTTGAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004121.1-1598s1c1
Sequence:CCGGGACAGGCATCATCCTCAACAACTCGAGTTGTTGAGGATGATGCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004121.1-878s1c1
Sequence:CCGGCCTCAGCCGTTTCCTGCACAACTCGAGTTGTGCAGGAAACGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004121.1-499s1c1
Sequence:CCGGGCTCGGATATTGGACGAGCCACTCGAGTGGCTCGTCCAATATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004121.1-1229s1c1
Sequence:CCGGCAACGTGCTAAGAGGGTTCAACTCGAGTTGAACCCTCTTAGCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004121.2-2006s21c1
Sequence:CCGGTGGAGTACGAGCCCAACTTCACTCGAGTGAAGTTGGGCTCGTACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004121.2-1832s21c1
Sequence:CCGGTGCCCTCCATCTTGATCAACACTCGAGTGTTGATCAAGATGGAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004121.2-1382s21c1
Sequence:CCGGTTGTAGAGACGCTCAAGTTTGCTCGAGCAAACTTGAGCGTCTCTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004121
GGT5 MISSION shRNA shRNA Plasmid DNA
gamma-glutamyltransferase 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004121.1-1247s1c1
Sequence:CCGGCAACTTCTCAACAGAGTCTATCTCGAGATAGACTCTGTTGAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004121.1-1598s1c1
Sequence:CCGGGACAGGCATCATCCTCAACAACTCGAGTTGTTGAGGATGATGCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004121.1-878s1c1
Sequence:CCGGCCTCAGCCGTTTCCTGCACAACTCGAGTTGTGCAGGAAACGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004121.1-499s1c1
Sequence:CCGGGCTCGGATATTGGACGAGCCACTCGAGTGGCTCGTCCAATATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004121.1-1229s1c1
Sequence:CCGGCAACGTGCTAAGAGGGTTCAACTCGAGTTGAACCCTCTTAGCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004121.2-2006s21c1
Sequence:CCGGTGGAGTACGAGCCCAACTTCACTCGAGTGAAGTTGGGCTCGTACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004121.2-1832s21c1
Sequence:CCGGTGCCCTCCATCTTGATCAACACTCGAGTGTTGATCAAGATGGAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004121.2-1382s21c1
Sequence:CCGGTTGTAGAGACGCTCAAGTTTGCTCGAGCAAACTTGAGCGTCTCTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004121
GGT5 MISSION shRNA Lentiviral Transduction Particles
gamma-glutamyltransferase 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004121.1-1247s1c1
Sequence:CCGGCAACTTCTCAACAGAGTCTATCTCGAGATAGACTCTGTTGAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004121.1-1598s1c1
Sequence:CCGGGACAGGCATCATCCTCAACAACTCGAGTTGTTGAGGATGATGCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004121.1-878s1c1
Sequence:CCGGCCTCAGCCGTTTCCTGCACAACTCGAGTTGTGCAGGAAACGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004121.1-499s1c1
Sequence:CCGGGCTCGGATATTGGACGAGCCACTCGAGTGGCTCGTCCAATATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004121.1-1229s1c1
Sequence:CCGGCAACGTGCTAAGAGGGTTCAACTCGAGTTGAACCCTCTTAGCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004121.2-2006s21c1
Sequence:CCGGTGGAGTACGAGCCCAACTTCACTCGAGTGAAGTTGGGCTCGTACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004121.2-1832s21c1
Sequence:CCGGTGCCCTCCATCTTGATCAACACTCGAGTGTTGATCAAGATGGAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004121.2-1382s21c1
Sequence:CCGGTTGTAGAGACGCTCAAGTTTGCTCGAGCAAACTTGAGCGTCTCTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks