EMAIL THIS PAGE TO A FRIEND

GGT6

gamma-glutamyltransferase 6

67 Gene Product Result for
UniProtKB ID: Q6P531, B4DUH4, Q8NCM0
Gene ID:
Human(124975) Summary: GGT6 belongs to the gamma-glutamyltransferase (GGT; EC 2.3.2.2) gene family. GGT is a membrane-bound extracellular enzyme that cleaves gamma-glutamyl peptide bonds in glutathione and other peptides and transfers the gamma-glutamyl moiety to acceptors. GGT is also key to glutathione homeostasis because it provides substrates for glutathione synthesis (Heisterkamp et al., 2008 [PubMed 18357469]
Mouse(71522) gamma-glutamyltransferase 6
Rat(408206) gamma-glutamyl transferase 6
domestic cat(101087792) gamma-glutamyltransferase 6
dog(606867) gamma-glutamyltransferase 6
cow(613919) gamma-glutamyltransferase 6
Horse(100060762) gamma-glutamyltransferase 6
sheep(101102912) gamma-glutamyltransferase 6
naked mole-rat(101700696) gamma-glutamyltransferase 6
domestic guinea pig(100726287) gamma-glutamyltransferase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153338 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026901 MISSION® esiRNA esiRNA human GGT6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122890 Rosetta Predictions human pricing
NM_153338 Rosetta Predictions human pricing
NM_001002820 Rosetta Predictions rat pricing
NM_027819 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327537 predicted 1004
2 SASI_Hs02_00327538 predicted 808
3 SASI_Hs02_00327539 predicted 756
4 SASI_Hs02_00327540 predicted 1130
5 SASI_Hs02_00327541 predicted 1214
6 SASI_Hs02_00327542 predicted 1173
7 SASI_Hs02_00327543 predicted 1272
8 SASI_Hs02_00327544 predicted 1356
9 SASI_Hs02_00327545 predicted 1379
10 SASI_Hs02_00327546 predicted 1339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239664 predicted 916
2 SASI_Hs02_00367187 predicted 712
3 SASI_Hs02_00367188 predicted 656
4 SASI_Hs02_00367189 predicted 1036
5 SASI_Hs02_00367190 predicted 1115
6 SASI_Hs02_00367191 predicted 1078
7 SASI_Hs02_00367192 predicted 1180
8 SASI_Hs01_00239666 predicted 1259
9 SASI_Hs01_00239668 predicted 1288
10 SASI_Hs01_00239669 predicted 1244
11 SASI_Hs01_00239662 predicted 428
12 SASI_Hs01_00239663 predicted 647
13 SASI_Hs01_00239665 predicted 280
14 SASI_Hs01_00239667 predicted 428
15 SASI_Hs01_00239670 predicted 1253
16 SASI_Hs01_00239671 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040499 predicted 1215
2 SASI_Rn01_00040500 predicted 320
3 SASI_Rn02_00198005 predicted 778
4 SASI_Rn01_00040501 predicted 1210
5 SASI_Rn01_00040502 predicted 1156
6 SASI_Rn01_00040503 predicted 679
7 SASI_Rn01_00040504 predicted 1118
8 SASI_Rn01_00040505 predicted 1152
9 SASI_Rn01_00040506 predicted 232
10 SASI_Rn01_00040507 predicted 1019
11 SASI_Rn01_00040508 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091851 predicted 808
2 SASI_Mm01_00091852 predicted 523
3 SASI_Mm01_00091855 predicted 1404
4 SASI_Mm02_00332775 predicted 518
5 SASI_Mm02_00332776 predicted 1068
6 SASI_Mm01_00091856 predicted 540
7 SASI_Mm01_00091857 predicted 1410
8 SASI_Mm01_00091858 predicted 872
9 SASI_Mm01_00091859 predicted 545
10 SASI_Mm01_00091860 predicted 510
11 SASI_Mm01_00091853 predicted 1667
12 SASI_Mm01_00091854 predicted 1630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153338
GGT6 MISSION shRNA Bacterial Glycerol Stock
gamma-glutamyltransferase 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153338.2-1317s21c1
Sequence:CCGGGGGTCAGCAAGAACCAACAGACTCGAGTCTGTTGGTTCTTGCTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153338.2-778s21c1
Sequence:CCGGGATGCTCTACTGAGTCTACTGCTCGAGCAGTAGACTCAGTAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153338.1-2233s1c1
Sequence:CCGGGCTAACAATCATTCTTCAGATCTCGAGATCTGAAGAATGATTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153338.1-661s1c1
Sequence:CCGGCCACTACTTTGCCATGCTGATCTCGAGATCAGCATGGCAAAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153338.1-1250s1c1
Sequence:CCGGCCATGACTCACACCCTACTCACTCGAGTGAGTAGGGTGTGAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153338.1-1053s1c1
Sequence:CCGGCCTTCTCACCTCCTCGCTCAACTCGAGTTGAGCGAGGAGGTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153338.1-426s1c1
Sequence:CCGGCCACGATAGCTCCTCAGGCAACTCGAGTTGCCTGAGGAGCTATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153338
GGT6 MISSION shRNA shRNA Plasmid DNA
gamma-glutamyltransferase 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153338.2-1317s21c1
Sequence:CCGGGGGTCAGCAAGAACCAACAGACTCGAGTCTGTTGGTTCTTGCTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153338.2-778s21c1
Sequence:CCGGGATGCTCTACTGAGTCTACTGCTCGAGCAGTAGACTCAGTAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153338.1-2233s1c1
Sequence:CCGGGCTAACAATCATTCTTCAGATCTCGAGATCTGAAGAATGATTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153338.1-661s1c1
Sequence:CCGGCCACTACTTTGCCATGCTGATCTCGAGATCAGCATGGCAAAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153338.1-1250s1c1
Sequence:CCGGCCATGACTCACACCCTACTCACTCGAGTGAGTAGGGTGTGAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153338.1-1053s1c1
Sequence:CCGGCCTTCTCACCTCCTCGCTCAACTCGAGTTGAGCGAGGAGGTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153338.1-426s1c1
Sequence:CCGGCCACGATAGCTCCTCAGGCAACTCGAGTTGCCTGAGGAGCTATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153338
GGT6 MISSION shRNA Lentiviral Transduction Particles
gamma-glutamyltransferase 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153338.2-1317s21c1
Sequence:CCGGGGGTCAGCAAGAACCAACAGACTCGAGTCTGTTGGTTCTTGCTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153338.2-778s21c1
Sequence:CCGGGATGCTCTACTGAGTCTACTGCTCGAGCAGTAGACTCAGTAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153338.1-2233s1c1
Sequence:CCGGGCTAACAATCATTCTTCAGATCTCGAGATCTGAAGAATGATTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153338.1-661s1c1
Sequence:CCGGCCACTACTTTGCCATGCTGATCTCGAGATCAGCATGGCAAAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153338.1-1250s1c1
Sequence:CCGGCCATGACTCACACCCTACTCACTCGAGTGAGTAGGGTGTGAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153338.1-1053s1c1
Sequence:CCGGCCTTCTCACCTCCTCGCTCAACTCGAGTTGAGCGAGGAGGTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153338.1-426s1c1
Sequence:CCGGCCACGATAGCTCCTCAGGCAACTCGAGTTGCCTGAGGAGCTATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027819
GGT6 MISSION shRNA Bacterial Glycerol Stock
gamma-glutamyltransferase 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027819.1-677s1c1
Sequence:CCGGGCATTTGCTTCATGCCCACTTCTCGAGAAGTGGGCATGAAGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027819.1-529s1c1
Sequence:CCGGCGGTGGTACATCCTCATGCAACTCGAGTTGCATGAGGATGTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027819.1-1140s1c1
Sequence:CCGGCATTCTTGCAAACTGCTTAAACTCGAGTTTAAGCAGTTTGCAAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027819.1-581s1c1
Sequence:CCGGCTACAATAGCTCTTCAGGAAACTCGAGTTTCCTGAAGAGCTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027819.1-816s1c1
Sequence:CCGGCCATTGTTCTGCCATACCAATCTCGAGATTGGTATGGCAGAACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027819
GGT6 MISSION shRNA shRNA Plasmid DNA
gamma-glutamyltransferase 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027819.1-677s1c1
Sequence:CCGGGCATTTGCTTCATGCCCACTTCTCGAGAAGTGGGCATGAAGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027819.1-529s1c1
Sequence:CCGGCGGTGGTACATCCTCATGCAACTCGAGTTGCATGAGGATGTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027819.1-1140s1c1
Sequence:CCGGCATTCTTGCAAACTGCTTAAACTCGAGTTTAAGCAGTTTGCAAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027819.1-581s1c1
Sequence:CCGGCTACAATAGCTCTTCAGGAAACTCGAGTTTCCTGAAGAGCTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027819.1-816s1c1
Sequence:CCGGCCATTGTTCTGCCATACCAATCTCGAGATTGGTATGGCAGAACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027819
GGT6 MISSION shRNA Lentiviral Transduction Particles
gamma-glutamyltransferase 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027819.1-677s1c1
Sequence:CCGGGCATTTGCTTCATGCCCACTTCTCGAGAAGTGGGCATGAAGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027819.1-529s1c1
Sequence:CCGGCGGTGGTACATCCTCATGCAACTCGAGTTGCATGAGGATGTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027819.1-1140s1c1
Sequence:CCGGCATTCTTGCAAACTGCTTAAACTCGAGTTTAAGCAGTTTGCAAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027819.1-581s1c1
Sequence:CCGGCTACAATAGCTCTTCAGGAAACTCGAGTTTCCTGAAGAGCTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027819.1-816s1c1
Sequence:CCGGCCATTGTTCTGCCATACCAATCTCGAGATTGGTATGGCAGAACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks