EMAIL THIS PAGE TO A FRIEND

GGT7

gamma-glutamyltransferase 7

156 Gene Product Result for
Synonyms: D20S101 GGT4 GGTL3 GGTL5 dJ18C9.2
UniProtKB ID: Q9UJ14, Q8N899, Q8NF66, Q9BYP5, Q9BYP6
Gene ID:
Human(2686) Summary: This gene is a member of a gene family that encodes enzymes involved in both the metabolism of glutathione and in the transpeptidation of amino acids. Changes in the activity of gamma-glutamyltransferase may signal preneoplastic or toxic conditions in the liver or kidney. The protein encoded by this gene consists of a heavy and a light chain, and it can interact with CT120, a plasma membrane-associated protein that is possibly involved in lung carcinogenesis. [provided by RefSeq, Jul 2008]
Mouse(207182) gamma-glutamyltransferase 7
Rat(156275) gamma-glutamyltransferase 7
domestic guinea pig(100732094) gamma-glutamyltransferase 7
naked mole-rat(101705019) gamma-glutamyltransferase 7
sheep(101113872) gamma-glutamyltransferase 7
Domestic Rabbit(100346442) gamma-glutamyltransferase 7
chicken(419121) gamma-glutamyltransferase 7
dog(485847) gamma-glutamyltransferase 7
cow(615929) gamma-glutamyltransferase 7
Horse(100054524) gamma-glutamyltransferase 7
domestic cat(101084698) gamma-glutamyltransferase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178025 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178026 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052830 Rosetta Predictions human pricing
NM_178025 Rosetta Predictions human pricing
NM_178026 Rosetta Predictions human pricing
NM_130423 Rosetta Predictions rat pricing
NM_144786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068719 predicted 371
2 SASI_Hs01_00068720 predicted 399
3 SASI_Hs01_00068721 predicted 208
4 SASI_Hs01_00068722 predicted 293
5 SASI_Hs01_00068723 predicted 249
6 SASI_Hs01_00068724 predicted 274
7 SASI_Hs01_00068725 predicted 491
8 SASI_Hs01_00068726 predicted 258
9 SASI_Hs01_00068727 predicted 411
10 SASI_Hs01_00068728 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080034 predicted 374
2 SASI_Hs01_00080035 predicted 402
3 SASI_Hs01_00080036 predicted 207
4 SASI_Hs01_00080037 predicted 290
5 SASI_Hs01_00080038 predicted 246
6 SASI_Hs01_00080039 predicted 273
7 SASI_Hs01_00080040 predicted 492
8 SASI_Hs01_00080041 predicted 255
9 SASI_Hs01_00080042 predicted 407
10 SASI_Hs01_00080043 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369503 predicted 631
2 SASI_Hs02_00369504 predicted 836
3 SASI_Hs02_00369505 predicted 1311
4 SASI_Hs02_00369506 predicted 1071
5 SASI_Hs02_00369507 predicted 1184
6 SASI_Hs02_00369508 predicted 697
7 SASI_Hs02_00369509 predicted 626
8 SASI_Hs02_00369510 predicted 1088
9 SASI_Hs02_00369511 predicted 504
10 SASI_Hs02_00369512 predicted 638
11 SASI_Hs01_00125654 predicted 371
12 SASI_Hs01_00125655 predicted 409
13 SASI_Hs01_00125656 predicted 213
14 SASI_Hs01_00125657 predicted 294
15 SASI_Hs01_00125658 predicted 245
16 SASI_Hs01_00125659 predicted 280
17 SASI_Hs01_00125660 predicted 501
18 SASI_Hs01_00125661 predicted 264
19 SASI_Hs01_00125662 predicted 417
20 SASI_Hs01_00125663 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130423 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108386 predicted 1262
2 SASI_Rn01_00108387 predicted 508
3 SASI_Rn01_00108388 predicted 779
4 SASI_Rn01_00108390 predicted 706
5 SASI_Rn02_00267423 predicted 575
6 SASI_Rn01_00108393 predicted 351
7 SASI_Rn01_00108394 predicted 1546
8 SASI_Rn02_00267424 predicted 1137
9 SASI_Rn02_00267425 predicted 1266
10 SASI_Rn01_00108395 predicted 592
11 SASI_Rn01_00108389 predicted 587
12 SASI_Rn01_00108391 predicted 1722
13 SASI_Rn01_00108392 predicted 1527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118672 predicted 1298
2 SASI_Mm01_00118673 predicted 1757
3 SASI_Mm01_00118674 predicted 677
4 SASI_Mm01_00118675 predicted 823
5 SASI_Mm01_00118676 predicted 611
6 SASI_Mm01_00118677 predicted 630
7 SASI_Mm01_00118678 predicted 1172
8 SASI_Mm01_00118680 predicted 552
9 SASI_Mm02_00340127 predicted 1558
10 SASI_Mm01_00118681 predicted 948
11 SASI_Mm01_00118679 predicted 596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144786
VALIDATED
GGT7 MISSION shRNA Bacterial Glycerol Stock
gamma-glutamyltransferase 7
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144786.1-727s1c1
Sequence:CCGGCCCGGAATGGTGAAAGGGTTACTCGAGTAACCCTTTCACCATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144786.1-1905s1c1
Sequence:CCGGCGTGGAGAAGGTAGATGTCTTCTCGAGAAGACATCTACCTTCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144786.1-74s1c1
Sequence:CCGGCCTACTCACCAGTGGACTATACTCGAGTATAGTCCACTGGTGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144786.1-837s1c1
Sequence:CCGGCCATGATCTAGCTCATGCCTTCTCGAGAAGGCATGAGCTAGATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144786.1-1302s1c1
Sequence:CCGGCCCTGTCTATGATTCTACCATCTCGAGATGGTAGAATCATAGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144786.2-905s21c1
Sequence:CCGGGACCGCTTCCTGGATACTTTCCTCGAGGAAAGTATCCAGGAAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144786.2-639s21c1
Sequence:CCGGGGAATGAGAGCCACCTAATTGCTCGAGCAATTAGGTGGCTCTCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144786.2-1093s21c1
Sequence:CCGGGGAGGACTTCAGCAACTATAGCTCGAGCTATAGTTGCTGAAGTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144786.2-613s21c1
Sequence:CCGGCGTGATGTTGGTACATGATATCTCGAGATATCATGTACCAACATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144786.2-2253s21c1
Sequence:CCGGGGACCTTGAGGAGTCAGATTGCTCGAGCAATCTGACTCCTCAAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144786.2-978s21c1
Sequence:CCGGTCGCTGAGGTACTGGATATACCTCGAGGTATATCCAGTACCTCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144786
VALIDATED
GGT7 MISSION shRNA shRNA Plasmid DNA
gamma-glutamyltransferase 7
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144786.1-727s1c1
Sequence:CCGGCCCGGAATGGTGAAAGGGTTACTCGAGTAACCCTTTCACCATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144786.1-1905s1c1
Sequence:CCGGCGTGGAGAAGGTAGATGTCTTCTCGAGAAGACATCTACCTTCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144786.1-74s1c1
Sequence:CCGGCCTACTCACCAGTGGACTATACTCGAGTATAGTCCACTGGTGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144786.1-837s1c1
Sequence:CCGGCCATGATCTAGCTCATGCCTTCTCGAGAAGGCATGAGCTAGATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144786.1-1302s1c1
Sequence:CCGGCCCTGTCTATGATTCTACCATCTCGAGATGGTAGAATCATAGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144786.2-905s21c1
Sequence:CCGGGACCGCTTCCTGGATACTTTCCTCGAGGAAAGTATCCAGGAAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144786.2-639s21c1
Sequence:CCGGGGAATGAGAGCCACCTAATTGCTCGAGCAATTAGGTGGCTCTCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144786.2-1093s21c1
Sequence:CCGGGGAGGACTTCAGCAACTATAGCTCGAGCTATAGTTGCTGAAGTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144786.2-613s21c1
Sequence:CCGGCGTGATGTTGGTACATGATATCTCGAGATATCATGTACCAACATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144786.2-2253s21c1
Sequence:CCGGGGACCTTGAGGAGTCAGATTGCTCGAGCAATCTGACTCCTCAAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144786.2-978s21c1
Sequence:CCGGTCGCTGAGGTACTGGATATACCTCGAGGTATATCCAGTACCTCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144786
VALIDATED
GGT7 MISSION shRNA Lentiviral Transduction Particles
gamma-glutamyltransferase 7
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144786.1-727s1c1
Sequence:CCGGCCCGGAATGGTGAAAGGGTTACTCGAGTAACCCTTTCACCATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144786.1-1905s1c1
Sequence:CCGGCGTGGAGAAGGTAGATGTCTTCTCGAGAAGACATCTACCTTCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144786.1-74s1c1
Sequence:CCGGCCTACTCACCAGTGGACTATACTCGAGTATAGTCCACTGGTGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144786.1-837s1c1
Sequence:CCGGCCATGATCTAGCTCATGCCTTCTCGAGAAGGCATGAGCTAGATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144786.1-1302s1c1
Sequence:CCGGCCCTGTCTATGATTCTACCATCTCGAGATGGTAGAATCATAGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144786.2-905s21c1
Sequence:CCGGGACCGCTTCCTGGATACTTTCCTCGAGGAAAGTATCCAGGAAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144786.2-639s21c1
Sequence:CCGGGGAATGAGAGCCACCTAATTGCTCGAGCAATTAGGTGGCTCTCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144786.2-1093s21c1
Sequence:CCGGGGAGGACTTCAGCAACTATAGCTCGAGCTATAGTTGCTGAAGTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144786.2-613s21c1
Sequence:CCGGCGTGATGTTGGTACATGATATCTCGAGATATCATGTACCAACATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144786.2-2253s21c1
Sequence:CCGGGGACCTTGAGGAGTCAGATTGCTCGAGCAATCTGACTCCTCAAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144786.2-978s21c1
Sequence:CCGGTCGCTGAGGTACTGGATATACCTCGAGGTATATCCAGTACCTCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178025
GGT7 MISSION shRNA Bacterial Glycerol Stock
gamma-glutamyltransferase 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178025.1-765s1c1
Sequence:CCGGCCTTCTGCTAACCCAAGCATTCTCGAGAATGCTTGGGTTAGCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178025.1-626s1c1
Sequence:CCGGGACGAAATGAGAGCCACCTAACTCGAGTTAGGTGGCTCTCATTTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178025.1-90s1c1
Sequence:CCGGGCCAGTGGACTACATGAGCATCTCGAGATGCTCATGTAGTCCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178025.1-506s1c1
Sequence:CCGGTGCTCAGTAAACAGGGATCTTCTCGAGAAGATCCCTGTTTACTGAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178025.1-1038s1c1
Sequence:CCGGCCCTTGATATATTGGAAGATTCTCGAGAATCTTCCAATATATCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178025
GGT7 MISSION shRNA shRNA Plasmid DNA
gamma-glutamyltransferase 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178025.1-765s1c1
Sequence:CCGGCCTTCTGCTAACCCAAGCATTCTCGAGAATGCTTGGGTTAGCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178025.1-626s1c1
Sequence:CCGGGACGAAATGAGAGCCACCTAACTCGAGTTAGGTGGCTCTCATTTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178025.1-90s1c1
Sequence:CCGGGCCAGTGGACTACATGAGCATCTCGAGATGCTCATGTAGTCCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178025.1-506s1c1
Sequence:CCGGTGCTCAGTAAACAGGGATCTTCTCGAGAAGATCCCTGTTTACTGAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178025.1-1038s1c1
Sequence:CCGGCCCTTGATATATTGGAAGATTCTCGAGAATCTTCCAATATATCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178025
GGT7 MISSION shRNA Lentiviral Transduction Particles
gamma-glutamyltransferase 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178025.1-765s1c1
Sequence:CCGGCCTTCTGCTAACCCAAGCATTCTCGAGAATGCTTGGGTTAGCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178025.1-626s1c1
Sequence:CCGGGACGAAATGAGAGCCACCTAACTCGAGTTAGGTGGCTCTCATTTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178025.1-90s1c1
Sequence:CCGGGCCAGTGGACTACATGAGCATCTCGAGATGCTCATGTAGTCCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178025.1-506s1c1
Sequence:CCGGTGCTCAGTAAACAGGGATCTTCTCGAGAAGATCCCTGTTTACTGAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178025.1-1038s1c1
Sequence:CCGGCCCTTGATATATTGGAAGATTCTCGAGAATCTTCCAATATATCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178026
GGT7 MISSION shRNA Bacterial Glycerol Stock
gamma-glutamyltransferase 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178026.2-1096s21c1
Sequence:CCGGCAGCAATTACAGCGCCCTTGTCTCGAGACAAGGGCGCTGTAATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178026.2-2348s21c1
Sequence:CCGGCTTAGGGATGTGCTTGCAAACCTCGAGGTTTGCAAGCACATCCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178026.2-1311s21c1
Sequence:CCGGGAGATCCCGTCTATGATTCTACTCGAGTAGAATCATAGACGGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178026.2-607s21c1
Sequence:CCGGCGTGATGCTGGTACATGACATCTCGAGATGTCATGTACCAGCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178026.2-1479s21c1
Sequence:CCGGTGGGACCTGATGACTTCATTGCTCGAGCAATGAAGTCATCAGGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178026.2-1271s21c1
Sequence:CCGGGAGACCCTGAAGATTGCATTACTCGAGTAATGCAATCTTCAGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178026.2-2283s21c1
Sequence:CCGGACCTTGAGGAATCAGACTATCCTCGAGGATAGTCTGATTCCTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178026
GGT7 MISSION shRNA shRNA Plasmid DNA
gamma-glutamyltransferase 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178026.2-1096s21c1
Sequence:CCGGCAGCAATTACAGCGCCCTTGTCTCGAGACAAGGGCGCTGTAATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178026.2-2348s21c1
Sequence:CCGGCTTAGGGATGTGCTTGCAAACCTCGAGGTTTGCAAGCACATCCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178026.2-1311s21c1
Sequence:CCGGGAGATCCCGTCTATGATTCTACTCGAGTAGAATCATAGACGGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178026.2-607s21c1
Sequence:CCGGCGTGATGCTGGTACATGACATCTCGAGATGTCATGTACCAGCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178026.2-1479s21c1
Sequence:CCGGTGGGACCTGATGACTTCATTGCTCGAGCAATGAAGTCATCAGGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178026.2-1271s21c1
Sequence:CCGGGAGACCCTGAAGATTGCATTACTCGAGTAATGCAATCTTCAGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178026.2-2283s21c1
Sequence:CCGGACCTTGAGGAATCAGACTATCCTCGAGGATAGTCTGATTCCTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178026
GGT7 MISSION shRNA Lentiviral Transduction Particles
gamma-glutamyltransferase 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178026.2-1096s21c1
Sequence:CCGGCAGCAATTACAGCGCCCTTGTCTCGAGACAAGGGCGCTGTAATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178026.2-2348s21c1
Sequence:CCGGCTTAGGGATGTGCTTGCAAACCTCGAGGTTTGCAAGCACATCCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178026.2-1311s21c1
Sequence:CCGGGAGATCCCGTCTATGATTCTACTCGAGTAGAATCATAGACGGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178026.2-607s21c1
Sequence:CCGGCGTGATGCTGGTACATGACATCTCGAGATGTCATGTACCAGCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178026.2-1479s21c1
Sequence:CCGGTGGGACCTGATGACTTCATTGCTCGAGCAATGAAGTCATCAGGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178026.2-1271s21c1
Sequence:CCGGGAGACCCTGAAGATTGCATTACTCGAGTAATGCAATCTTCAGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178026.2-2283s21c1
Sequence:CCGGACCTTGAGGAATCAGACTATCCTCGAGGATAGTCTGATTCCTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks