EMAIL THIS PAGE TO A FRIEND

GGTLC1

gamma-glutamyltransferase light chain 1

25 Gene Product Result for
Synonyms: GGTL6 GGTLA3 GGTLA4 dJ831C21.1 dJ831C21.2
Species: Human GGTLC1(92086)
UniProtKB ID: Q9BX51, D3DW43, Q08246
Gene ID:
Human(92086) Summary: This gene encodes a member of the gamma-glutamyl transpeptidase (GGT) family, which are important in the metabolism of glutathione. The most ubiquitously expressed human GGT gene, GGT1, encodes a single transmembrane polypeptide that is post-translationally processed to form a heavy and a light chain. In contrast, the product of this gene only contains homology to the light chain region, and lacks a transmembrane domain. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Oct 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302943 ANTI-GGTL1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
AV41639 Anti-GGTLA4 antibody produced in rabbit IgG fraction of antiserum mouse, canine, horse, rabbit, guinea pig, pig, human, rat
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080920 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178312 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128411 MISSION® esiRNA esiRNA human GGTLA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080920 Rosetta Predictions human pricing
NM_178311 Rosetta Predictions human pricing
NM_178312 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182442 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084348 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016425 predicted 329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080920
VALIDATED
GGTLC1 MISSION shRNA Bacterial Glycerol Stock
gamma-glutamyltransferase light chain 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080920.2-343s1c1
Sequence:CCGGCCCGAGTTCTACATGCCGGATCTCGAGATCCGGCATGTAGAACTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080920.2-778s1c1
Sequence:CCGGGAGAGAAACATTGACCAGGAACTCGAGTTCCTGGTCAATGTTTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_080920.2-511s1c1
Sequence:CCGGACCAGCATCACCAACGAGTTTCTCGAGAAACTCGTTGGTGATGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080920.2-684s1c1
Sequence:CCGGCATCATCTACAACCTCTGGTTCTCGAGAACCAGAGGTTGTAGATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080920.2-478s1c1
Sequence:CCGGCTGCTCAATAATGAAATGGATCTCGAGATCCATTTCATTATTGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080920
VALIDATED
GGTLC1 MISSION shRNA shRNA Plasmid DNA
gamma-glutamyltransferase light chain 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080920.2-343s1c1
Sequence:CCGGCCCGAGTTCTACATGCCGGATCTCGAGATCCGGCATGTAGAACTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080920.2-778s1c1
Sequence:CCGGGAGAGAAACATTGACCAGGAACTCGAGTTCCTGGTCAATGTTTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_080920.2-511s1c1
Sequence:CCGGACCAGCATCACCAACGAGTTTCTCGAGAAACTCGTTGGTGATGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080920.2-684s1c1
Sequence:CCGGCATCATCTACAACCTCTGGTTCTCGAGAACCAGAGGTTGTAGATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080920.2-478s1c1
Sequence:CCGGCTGCTCAATAATGAAATGGATCTCGAGATCCATTTCATTATTGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080920
VALIDATED
GGTLC1 MISSION shRNA Lentiviral Transduction Particles
gamma-glutamyltransferase light chain 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080920.2-343s1c1
Sequence:CCGGCCCGAGTTCTACATGCCGGATCTCGAGATCCGGCATGTAGAACTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080920.2-778s1c1
Sequence:CCGGGAGAGAAACATTGACCAGGAACTCGAGTTCCTGGTCAATGTTTCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_080920.2-511s1c1
Sequence:CCGGACCAGCATCACCAACGAGTTTCTCGAGAAACTCGTTGGTGATGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080920.2-684s1c1
Sequence:CCGGCATCATCTACAACCTCTGGTTCTCGAGAACCAGAGGTTGTAGATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080920.2-478s1c1
Sequence:CCGGCTGCTCAATAATGAAATGGATCTCGAGATCCATTTCATTATTGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178312
VALIDATED
GGTLC1 MISSION shRNA Bacterial Glycerol Stock
gamma-glutamyltransferase light chain 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-294s21c1
Sequence:CCGGGCACCATCAACCTCTACTTTGCTCGAGCAAAGTAGAGGTTGATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-705s21c1
Sequence:CCGGAGATCACGTCCACCTTCATTGCTCGAGCAATGAAGGTGGACGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-338s21c1
Sequence:CCGGAGCGGGATCCTGCTCAATAATCTCGAGATTATTGAGCAGGATCCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-822s21c1
Sequence:CCGGCGGACAAGGCTGACAAGCAATCTCGAGATTGCTTGTCAGCCTTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-410s21c1
Sequence:CCGGCCCTCACCTGCCAATTTCATCCTCGAGGATGAAATTGGCAGGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178312.2-794s21c1
Sequence:CCGGGAACCTGCTGGCTACTGATTGCTCGAGCAATCAGTAGCCAGCAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-189s21c1
Sequence:CCGGCTCACCCGATCTCCTACTACACTCGAGTGTAGTAGGAGATCGGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-381s21c1
Sequence:CCGGCCAGCATCACCAACGAGTTTGCTCGAGCAAACTCGTTGGTGATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178312
VALIDATED
GGTLC1 MISSION shRNA shRNA Plasmid DNA
gamma-glutamyltransferase light chain 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-294s21c1
Sequence:CCGGGCACCATCAACCTCTACTTTGCTCGAGCAAAGTAGAGGTTGATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-705s21c1
Sequence:CCGGAGATCACGTCCACCTTCATTGCTCGAGCAATGAAGGTGGACGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-338s21c1
Sequence:CCGGAGCGGGATCCTGCTCAATAATCTCGAGATTATTGAGCAGGATCCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-822s21c1
Sequence:CCGGCGGACAAGGCTGACAAGCAATCTCGAGATTGCTTGTCAGCCTTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-410s21c1
Sequence:CCGGCCCTCACCTGCCAATTTCATCCTCGAGGATGAAATTGGCAGGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178312.2-794s21c1
Sequence:CCGGGAACCTGCTGGCTACTGATTGCTCGAGCAATCAGTAGCCAGCAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-189s21c1
Sequence:CCGGCTCACCCGATCTCCTACTACACTCGAGTGTAGTAGGAGATCGGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-381s21c1
Sequence:CCGGCCAGCATCACCAACGAGTTTGCTCGAGCAAACTCGTTGGTGATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178312
VALIDATED
GGTLC1 MISSION shRNA Lentiviral Transduction Particles
gamma-glutamyltransferase light chain 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-294s21c1
Sequence:CCGGGCACCATCAACCTCTACTTTGCTCGAGCAAAGTAGAGGTTGATGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-705s21c1
Sequence:CCGGAGATCACGTCCACCTTCATTGCTCGAGCAATGAAGGTGGACGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-338s21c1
Sequence:CCGGAGCGGGATCCTGCTCAATAATCTCGAGATTATTGAGCAGGATCCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-822s21c1
Sequence:CCGGCGGACAAGGCTGACAAGCAATCTCGAGATTGCTTGTCAGCCTTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-410s21c1
Sequence:CCGGCCCTCACCTGCCAATTTCATCCTCGAGGATGAAATTGGCAGGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178312.2-794s21c1
Sequence:CCGGGAACCTGCTGGCTACTGATTGCTCGAGCAATCAGTAGCCAGCAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-189s21c1
Sequence:CCGGCTCACCCGATCTCCTACTACACTCGAGTGTAGTAGGAGATCGGGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_178312.2-381s21c1
Sequence:CCGGCCAGCATCACCAACGAGTTTGCTCGAGCAAACTCGTTGGTGATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)