EMAIL THIS PAGE TO A FRIEND

GGTLC2

gamma-glutamyltransferase light chain 2

33 Gene Product Result for
Synonyms: GGTL4
Species: Human GGTLC2(91227)
UniProtKB ID: Q14390, A1A516, A2VCM9, Q5NV76, Q6ISH0
Gene ID:
Human(91227) Summary: Gamma-glutamyltransferase-1 (GGT1; MIM 612346) is a membrane-bound extracellular enzyme that cleaves gamma-glutamyl peptide bonds in glutathione and other peptides and transfers the gamma-glutamyl moiety to acceptors. Autocatalytic cleavage of the GGT1 precursor polypeptide produces a heavy chain and a light chain that associate with each other to form the functional enzyme. Light chain-only GGTs, such as GGTLC2, contain a region corresponding to the GGT1 light chain, but they lack the membrane-anchoring heavy chain region (Heisterkamp et al., 2008 [PubMed 18357469]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301682 ANTI-GGTL2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing
SAB1301124 ANTI-GGTLC2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080839 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113071 MISSION® esiRNA esiRNA human GGT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080839 Rosetta Predictions human pricing
NM_199127 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216167 predicted 237
2 SASI_Hs01_00216168 predicted 242
3 SASI_Hs01_00216169 predicted 251
4 SASI_Hs01_00216170 predicted 245
5 SASI_Hs01_00216171 predicted 278
6 SASI_Hs01_00216172 predicted 282
7 SASI_Hs01_00216173 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151674 predicted 247
2 SASI_Hs01_00151676 predicted 274
3 SASI_Hs01_00151677 predicted 276
4 SASI_Hs01_00151673 predicted 239
5 SASI_Hs01_00151675 predicted 242
6 SASI_Hs01_00151678 predicted 787
7 SASI_Hs01_00151672 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080839
VALIDATED
GGTLC2 MISSION shRNA Bacterial Glycerol Stock
gamma-glutamyltransferase light chain 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080839.4-236s1c1
Sequence:CCGGGTCAGCGAGATCCTGTTCAATCTCGAGATTGAACAGGATCTCGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080839.4-239s1c1
Sequence:CCGGAGCGAGATCCTGTTCAATGATCTCGAGATCATTGAACAGGATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080839.4-247s1c1
Sequence:CCGGCCTGTTCAATGATGAAATGGACTCGAGTCCATTTCATCATTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080839.4-253s1c1
Sequence:CCGGCAATGATGAAATGGATGACTTCTCGAGAAGTCATCCATTTCATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_080839.4-718s1c1
Sequence:CCGGCCAGGAGGACAAGGCTGACAACTCGAGTTGTCAGCCTTGTCCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080839
VALIDATED
GGTLC2 MISSION shRNA shRNA Plasmid DNA
gamma-glutamyltransferase light chain 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080839.4-236s1c1
Sequence:CCGGGTCAGCGAGATCCTGTTCAATCTCGAGATTGAACAGGATCTCGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080839.4-239s1c1
Sequence:CCGGAGCGAGATCCTGTTCAATGATCTCGAGATCATTGAACAGGATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080839.4-247s1c1
Sequence:CCGGCCTGTTCAATGATGAAATGGACTCGAGTCCATTTCATCATTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080839.4-253s1c1
Sequence:CCGGCAATGATGAAATGGATGACTTCTCGAGAAGTCATCCATTTCATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_080839.4-718s1c1
Sequence:CCGGCCAGGAGGACAAGGCTGACAACTCGAGTTGTCAGCCTTGTCCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080839
VALIDATED
GGTLC2 MISSION shRNA Lentiviral Transduction Particles
gamma-glutamyltransferase light chain 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080839.4-236s1c1
Sequence:CCGGGTCAGCGAGATCCTGTTCAATCTCGAGATTGAACAGGATCTCGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080839.4-239s1c1
Sequence:CCGGAGCGAGATCCTGTTCAATGATCTCGAGATCATTGAACAGGATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080839.4-247s1c1
Sequence:CCGGCCTGTTCAATGATGAAATGGACTCGAGTCCATTTCATCATTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080839.4-253s1c1
Sequence:CCGGCAATGATGAAATGGATGACTTCTCGAGAAGTCATCCATTTCATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_080839.4-718s1c1
Sequence:CCGGCCAGGAGGACAAGGCTGACAACTCGAGTTGTCAGCCTTGTCCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks