EMAIL THIS PAGE TO A FRIEND

GH1

growth hormone 1

Synonyms: GH GH-N GHN IGHD1B hGH-N
Gene ID:
Human(2688) Summary: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones which play an important role in growth control. The gene, along with four other related genes, is located at the growth hormone locus on chromosome 17 where they are interspersed in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. The five genes share a remarkably high degree of sequence identity. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. This particular family member is expressed in the pituitary but not in placental tissue as is the case for the other four genes in the growth hormone locus. Mutations in or deletions of the gene lead to growth hormone deficiency and short stature. [provided by RefSeq, Jul 2008]
Rat(24391) growth hormone 1
Goat(100861230) growth hormone 1
naked mole-rat(101712254) growth hormone 1
Zebrafish(407639) growth hormone 1
dog(403795) growth hormone
cow(280804) growth hormone 1
Horse(100034180) growth hormone 1
domestic cat(493931) growth hormone 1
121 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000515 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000515 Rosetta Predictions human pricing
NM_022559 Rosetta Predictions human pricing
NM_022560 Rosetta Predictions human pricing
NM_022561 Rosetta Predictions human pricing
NM_022562 Rosetta Predictions human pricing
NM_001034848 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302703 predicted 463
2 SASI_Hs02_00302704 predicted 407
3 SASI_Hs02_00302705 predicted 452
4 SASI_Hs02_00302706 predicted 317
5 SASI_Hs01_00016676 predicted 591
6 SASI_Hs01_00016677 predicted 596
7 SASI_Hs01_00016678 predicted 598
8 SASI_Hs01_00016679 predicted 595
9 SASI_Hs01_00016680 predicted 577
10 SASI_Hs01_00016681 predicted 489
11 SASI_Hs01_00016682 predicted 566
12 SASI_Hs01_00016683 predicted 589
13 SASI_Hs01_00016684 predicted 588
14 SASI_Hs01_00016685 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355846 predicted 415
2 SASI_Hs02_00355847 predicted 365
3 SASI_Hs02_00355848 predicted 409
4 SASI_Hs02_00355849 predicted 278
5 SASI_Hs01_00242031 predicted 537
6 SASI_Hs01_00242032 predicted 552
7 SASI_Hs01_00242033 predicted 550
8 SASI_Hs01_00242034 predicted 542
9 SASI_Hs01_00242035 predicted 537
10 SASI_Hs01_00242036 predicted 447
11 SASI_Hs01_00242037 predicted 521
12 SASI_Hs01_00242038 predicted 551
13 SASI_Hs01_00242039 predicted 544
14 SASI_Hs01_00242040 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173946 predicted 343
2 SASI_Hs01_00173949 predicted 226
3 SASI_Hs01_00173950 predicted 215
4 SASI_Hs02_00355850 predicted 315
5 SASI_Hs01_00173953 predicted 288
6 SASI_Hs01_00173955 predicted 344
7 SASI_Hs02_00355851 predicted 330
8 SASI_Hs02_00355852 predicted 210
9 SASI_Hs01_00173947 predicted 457
10 SASI_Hs01_00173948 predicted 219
11 SASI_Hs01_00173951 predicted 329
12 SASI_Hs01_00173952 predicted 478
13 SASI_Hs01_00173954 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355853 predicted 220
2 SASI_Hs02_00355854 predicted 216
3 SASI_Hs01_00242178 predicted 226
4 SASI_Hs02_00355855 predicted 225
5 SASI_Hs02_00355856 predicted 216
6 SASI_Hs01_00242174 predicted 297
7 SASI_Hs01_00242175 predicted 307
8 SASI_Hs01_00242176 predicted 302
9 SASI_Hs01_00242177 predicted 298
10 SASI_Hs01_00242179 predicted 280
11 SASI_Hs01_00242180 predicted 213
12 SASI_Hs01_00242181 predicted 311
13 SASI_Hs01_00242182 predicted 304
14 SASI_Hs01_00242183 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033279 predicted 146
2 SASI_Hs01_00033280 predicted 176
3 SASI_Hs01_00033281 predicted 218
4 SASI_Hs01_00033282 predicted 140
5 SASI_Hs01_00033283 predicted 197
6 SASI_Hs01_00033284 predicted 219
7 SASI_Hs01_00033285 predicted 151
8 SASI_Hs01_00033286 predicted 147
9 SASI_Hs01_00033287 predicted 124
10 SASI_Hs01_00033288 predicted 194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034848 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101333 predicted 279
2 SASI_Rn01_00101334 predicted 204
3 SASI_Rn01_00101335 predicted 220
4 SASI_Rn02_00204039 predicted 456
5 SASI_Rn02_00204040 predicted 329
6 SASI_Rn02_00204041 predicted 336
7 SASI_Rn01_00101336 predicted 253
8 SASI_Rn02_00204042 predicted 411
9 SASI_Rn01_00101339 predicted 278
10 SASI_Rn01_00101340 predicted 220
11 SASI_Rn01_00101337 predicted 347
12 SASI_Rn01_00101338 predicted 289
13 SASI_Rn01_00101341 predicted 213
14 SASI_Rn01_00101342 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000515
GH1 MISSION shRNA Bacterial Glycerol Stock
growth hormone 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000515.3-463s1c1
Sequence:CCGGGCAACGTCTATGACCTCCTAACTCGAGTTAGGAGGTCATAGACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000515.3-566s1c1
Sequence:CCGGCTACAGCAAGTTCGACACAAACTCGAGTTTGTGTCGAACTTGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000515.3-575s1c1
Sequence:CCGGGTTCGACACAAACTCACACAACTCGAGTTGTGTGAGTTTGTGTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000515.3-548s1c1
Sequence:CCGGGCAGATCTTCAAGCAGACCTACTCGAGTAGGTCTGCTTGAAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000515.3-293s1c1
Sequence:CCGGCCTCTGTTTCTCAGAGTCTATCTCGAGATAGACTCTGAGAAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000515.3-228s21c1
Sequence:CCGGGAGTTTGAAGAAGCCTATATCCTCGAGGATATAGGCTTCTTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000515.3-140s21c1
Sequence:CCGGCTTCCCAACCATTCCCTTATCCTCGAGGATAAGGGAATGGTTGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000515.3-487s21c1
Sequence:CCGGACCTAGAGGAAGGCATCCAAACTCGAGTTTGGATGCCTTCCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000515
GH1 MISSION shRNA shRNA Plasmid DNA
growth hormone 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000515.3-463s1c1
Sequence:CCGGGCAACGTCTATGACCTCCTAACTCGAGTTAGGAGGTCATAGACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000515.3-566s1c1
Sequence:CCGGCTACAGCAAGTTCGACACAAACTCGAGTTTGTGTCGAACTTGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000515.3-575s1c1
Sequence:CCGGGTTCGACACAAACTCACACAACTCGAGTTGTGTGAGTTTGTGTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000515.3-548s1c1
Sequence:CCGGGCAGATCTTCAAGCAGACCTACTCGAGTAGGTCTGCTTGAAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000515.3-293s1c1
Sequence:CCGGCCTCTGTTTCTCAGAGTCTATCTCGAGATAGACTCTGAGAAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000515.3-228s21c1
Sequence:CCGGGAGTTTGAAGAAGCCTATATCCTCGAGGATATAGGCTTCTTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000515.3-140s21c1
Sequence:CCGGCTTCCCAACCATTCCCTTATCCTCGAGGATAAGGGAATGGTTGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000515.3-487s21c1
Sequence:CCGGACCTAGAGGAAGGCATCCAAACTCGAGTTTGGATGCCTTCCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000515
GH1 MISSION shRNA Lentiviral Transduction Particles
growth hormone 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000515.3-463s1c1
Sequence:CCGGGCAACGTCTATGACCTCCTAACTCGAGTTAGGAGGTCATAGACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000515.3-566s1c1
Sequence:CCGGCTACAGCAAGTTCGACACAAACTCGAGTTTGTGTCGAACTTGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000515.3-575s1c1
Sequence:CCGGGTTCGACACAAACTCACACAACTCGAGTTGTGTGAGTTTGTGTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000515.3-548s1c1
Sequence:CCGGGCAGATCTTCAAGCAGACCTACTCGAGTAGGTCTGCTTGAAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000515.3-293s1c1
Sequence:CCGGCCTCTGTTTCTCAGAGTCTATCTCGAGATAGACTCTGAGAAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000515.3-228s21c1
Sequence:CCGGGAGTTTGAAGAAGCCTATATCCTCGAGGATATAGGCTTCTTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000515.3-140s21c1
Sequence:CCGGCTTCCCAACCATTCCCTTATCCTCGAGGATAAGGGAATGGTTGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000515.3-487s21c1
Sequence:CCGGACCTAGAGGAAGGCATCCAAACTCGAGTTTGGATGCCTTCCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks