EMAIL THIS PAGE TO A FRIEND

GH2

growth hormone 2

90 Gene Product Result for
Synonyms: GH-V GHL GHV hGH-V
Species: Human GH2(2689)
UniProtKB ID: P01242, B1A4H5, B1A4H7, O14643, O14644, P09587
Gene ID:
Human(2689) Summary: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones which play an important role in growth control. The gene, along with four other related genes, is located at the growth hormone locus on chromosome 17 where they are interspersed in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. The five genes share a remarkably high degree of sequence identity. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. As in the case of its pituitary counterpart, growth hormone 1, the predominant isoform of this particular family member shows similar somatogenic activity, with reduced lactogenic activity. Mutations in this gene lead to placental growth hormone/lactogen deficiency. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002059 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002059 Rosetta Predictions human pricing
NM_022556 Rosetta Predictions human pricing
NM_022557 Rosetta Predictions human pricing
NM_022558 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049744 predicted 233
2 SASI_Hs01_00049747 predicted 241
3 SASI_Hs01_00049748 predicted 196
4 SASI_Hs02_00333103 predicted 237
5 SASI_Hs01_00049751 predicted 201
6 SASI_Hs02_00333104 predicted 199
7 SASI_Hs02_00333105 predicted 248
8 SASI_Hs02_00333106 predicted 190
9 SASI_Hs02_00333107 predicted 299
10 SASI_Hs02_00333108 predicted 318
11 SASI_Hs01_00049745 predicted 221
12 SASI_Hs01_00049746 predicted 251
13 SASI_Hs01_00049749 predicted 233
14 SASI_Hs01_00049750 predicted 222
15 SASI_Hs01_00049752 predicted 285
16 SASI_Hs01_00049753 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169763 predicted 260
2 SASI_Hs01_00169765 predicted 203
3 SASI_Hs01_00169766 predicted 501
4 SASI_Hs01_00169767 predicted 267
5 SASI_Hs01_00169770 predicted 414
6 SASI_Hs01_00169772 predicted 294
7 SASI_Hs02_00355831 predicted 293
8 SASI_Hs02_00355832 predicted 501
9 SASI_Hs02_00355833 predicted 190
10 SASI_Hs02_00355834 predicted 194
11 SASI_Hs01_00169764 predicted 253
12 SASI_Hs01_00169768 predicted 549
13 SASI_Hs01_00169769 predicted 449
14 SASI_Hs01_00169771 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046298 predicted 240
2 SASI_Hs01_00046302 predicted 243
3 SASI_Hs01_00046303 predicted 196
4 SASI_Hs02_00355835 predicted 232
5 SASI_Hs01_00046306 predicted 203
6 SASI_Hs02_00355836 predicted 202
7 SASI_Hs02_00355837 predicted 246
8 SASI_Hs02_00355838 predicted 299
9 SASI_Hs02_00355839 predicted 314
10 SASI_Hs01_00046299 predicted 215
11 SASI_Hs01_00046300 predicted 257
12 SASI_Hs01_00046301 predicted 298
13 SASI_Hs01_00046304 predicted 225
14 SASI_Hs01_00046305 predicted 223
15 SASI_Hs01_00046307 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230048 predicted 234
2 SASI_Hs01_00230052 predicted 240
3 SASI_Hs01_00230053 predicted 202
4 SASI_Hs02_00355840 predicted 233
5 SASI_Hs01_00230056 predicted 201
6 SASI_Hs02_00355841 predicted 202
7 SASI_Hs02_00355842 predicted 243
8 SASI_Hs02_00355843 predicted 192
9 SASI_Hs02_00355844 predicted 300
10 SASI_Hs02_00355845 predicted 318
11 SASI_Hs01_00230049 predicted 221
12 SASI_Hs01_00230050 predicted 257
13 SASI_Hs01_00230051 predicted 298
14 SASI_Hs01_00230054 predicted 230
15 SASI_Hs01_00230055 predicted 214
16 SASI_Hs01_00230057 predicted 284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002059
GH2 MISSION shRNA Bacterial Glycerol Stock
growth hormone 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002059.3-233s21c1
Sequence:CCGGTGAAGAAGCCTATATCCTGAACTCGAGTTCAGGATATAGGCTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002059.3-545s21c1
Sequence:CCGGTGGGCAGATCTTCAATCAGTCCTCGAGGACTGATTGAAGATCTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002059.3-195s21c1
Sequence:CCGGCGCCTGTACCAGCTGGCATATCTCGAGATATGCCAGCTGGTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002059.3-212s21c1
Sequence:CCGGATATGACACCTATCAGGAGTTCTCGAGAACTCCTGATAGGTGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002059.3-318s1c1
Sequence:CCGGACACCTTCCAACAGGGTGAAACTCGAGTTTCACCCTGTTGGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002059.3-204s1c1
Sequence:CCGGCAGCTGGCATATGACACCTATCTCGAGATAGGTGTCATATGCCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002059.3-148s1c1
Sequence:CCGGCCATTCCCTTATCCAGGCTTTCTCGAGAAAGCCTGGATAAGGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002059.3-463s1c1
Sequence:CCGGGCAACGTCTATCGCCACCTGACTCGAGTCAGGTGGCGATAGACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002059.3-242s1c1
Sequence:CCGGCTATATCCTGAAGGAGCAGAACTCGAGTTCTGCTCCTTCAGGATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002059
GH2 MISSION shRNA shRNA Plasmid DNA
growth hormone 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002059.3-233s21c1
Sequence:CCGGTGAAGAAGCCTATATCCTGAACTCGAGTTCAGGATATAGGCTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002059.3-545s21c1
Sequence:CCGGTGGGCAGATCTTCAATCAGTCCTCGAGGACTGATTGAAGATCTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002059.3-195s21c1
Sequence:CCGGCGCCTGTACCAGCTGGCATATCTCGAGATATGCCAGCTGGTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002059.3-212s21c1
Sequence:CCGGATATGACACCTATCAGGAGTTCTCGAGAACTCCTGATAGGTGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002059.3-318s1c1
Sequence:CCGGACACCTTCCAACAGGGTGAAACTCGAGTTTCACCCTGTTGGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002059.3-204s1c1
Sequence:CCGGCAGCTGGCATATGACACCTATCTCGAGATAGGTGTCATATGCCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002059.3-148s1c1
Sequence:CCGGCCATTCCCTTATCCAGGCTTTCTCGAGAAAGCCTGGATAAGGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002059.3-463s1c1
Sequence:CCGGGCAACGTCTATCGCCACCTGACTCGAGTCAGGTGGCGATAGACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002059.3-242s1c1
Sequence:CCGGCTATATCCTGAAGGAGCAGAACTCGAGTTCTGCTCCTTCAGGATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002059
GH2 MISSION shRNA Lentiviral Transduction Particles
growth hormone 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002059.3-233s21c1
Sequence:CCGGTGAAGAAGCCTATATCCTGAACTCGAGTTCAGGATATAGGCTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002059.3-545s21c1
Sequence:CCGGTGGGCAGATCTTCAATCAGTCCTCGAGGACTGATTGAAGATCTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002059.3-195s21c1
Sequence:CCGGCGCCTGTACCAGCTGGCATATCTCGAGATATGCCAGCTGGTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002059.3-212s21c1
Sequence:CCGGATATGACACCTATCAGGAGTTCTCGAGAACTCCTGATAGGTGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002059.3-318s1c1
Sequence:CCGGACACCTTCCAACAGGGTGAAACTCGAGTTTCACCCTGTTGGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002059.3-204s1c1
Sequence:CCGGCAGCTGGCATATGACACCTATCTCGAGATAGGTGTCATATGCCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002059.3-148s1c1
Sequence:CCGGCCATTCCCTTATCCAGGCTTTCTCGAGAAAGCCTGGATAAGGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002059.3-463s1c1
Sequence:CCGGGCAACGTCTATCGCCACCTGACTCGAGTCAGGTGGCGATAGACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002059.3-242s1c1
Sequence:CCGGCTATATCCTGAAGGAGCAGAACTCGAGTTCTGCTCCTTCAGGATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks