EMAIL THIS PAGE TO A FRIEND

GHDC

GH3 domain containing

80 Gene Product Result for
Synonyms: D11LGP1 LGP1
UniProtKB ID: Q8N2G8, B4DQS4, E9PDB5, Q9BXM6
Gene ID:
Mouse(80860) GH3 domain containing
Rat(303542) GH3 domain containing
Zebrafish(497449) GH3 domain containing
cow(515225) GH3 domain containing
Horse(100066203) GH3 domain containing
domestic cat(101095451) GH3 domain containing
dog(607630) GH3 domain containing
chicken(420028) GH3 domain containing
naked mole-rat(101723659) GH3 domain containing
domestic guinea pig(100717638) GH3 domain containing
sheep(101122535) GH3 domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032484 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031871 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031871 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031871 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053931 MISSION® esiRNA esiRNA human GHDC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032484 Rosetta Predictions human pricing
XM_001081466 Rosetta Predictions rat pricing
XM_220981 Rosetta Predictions rat pricing
NM_031871 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033209 predicted 1039
2 SASI_Hs01_00033210 predicted 1074
3 SASI_Hs01_00033211 predicted 683
4 SASI_Hs02_00359944 predicted 674
5 SASI_Hs01_00033212 predicted 1568
6 SASI_Hs01_00033213 predicted 1625
7 SASI_Hs01_00033214 predicted 1698
8 SASI_Hs01_00033215 predicted 712
9 SASI_Hs01_00033216 predicted 789
10 SASI_Hs01_00033217 predicted 706
11 SASI_Hs01_00033218 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372021 predicted 388
2 SASI_Rn02_00372022 predicted 271
3 SASI_Rn02_00372023 predicted 1616
4 SASI_Rn02_00372024 predicted 1461
5 SASI_Rn02_00372025 predicted 1601
6 SASI_Rn02_00372026 predicted 1394
7 SASI_Rn02_00372027 predicted 1181
8 SASI_Rn02_00372028 predicted 1155
9 SASI_Rn02_00372029 predicted 665
10 SASI_Rn02_00372030 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379714 predicted 388
2 SASI_Rn02_00379715 predicted 1102
3 SASI_Rn02_00379716 predicted 271
4 SASI_Rn02_00379717 predicted 278
5 SASI_Rn02_00379718 predicted 272
6 SASI_Rn02_00379719 predicted 1038
7 SASI_Rn02_00379720 predicted 622
8 SASI_Rn02_00379721 predicted 263
9 SASI_Rn02_00379722 predicted 798
10 SASI_Rn02_00379723 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031871 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191660 predicted 1742
2 SASI_Mm01_00191662 predicted 1776
3 SASI_Mm01_00191663 predicted 485
4 SASI_Mm01_00191664 predicted 1260
5 SASI_Mm01_00191665 predicted 1201
6 SASI_Mm01_00191666 predicted 674
7 SASI_Mm01_00191667 predicted 1496
8 SASI_Mm01_00191668 predicted 1719
9 SASI_Mm01_00191669 predicted 531
10 SASI_Mm02_00337185 predicted 988
11 SASI_Mm01_00191661 predicted 956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032484
GHDC MISSION shRNA Bacterial Glycerol Stock
GH3 domain containing
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032484.3-853s1c1
Sequence:CCGGCTAAACAAGGCCTACCCAGAACTCGAGTTCTGGGTAGGCCTTGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032484.3-699s1c1
Sequence:CCGGGAGCACAGACATAAGCACCTTCTCGAGAAGGTGCTTATGTCTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163804    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032484.3-2411s1c1
Sequence:CCGGGCAGCAACCCTGAGTCAATAACTCGAGTTATTGACTCAGGGTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158430    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032484.3-2463s1c1
Sequence:CCGGCAGGACAATTCTGAAGTGTATCTCGAGATACACTTCAGAATTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032484.3-1552s1c1
Sequence:CCGGGTTGGTGCCTACAATCAGTGTCTCGAGACACTGATTGTAGGCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032484.3-2485s1c1
Sequence:CCGGCTACATAAACTCTCAGAGGATCTCGAGATCCTCTGAGAGTTTATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032484.3-723s1c1
Sequence:CCGGGAATCATCTCCCTCTGACCAACTCGAGTTGGTCAGAGGGAGATGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032484.3-695s1c1
Sequence:CCGGGAAGGAGCACAGACATAAGCACTCGAGTGCTTATGTCTGTGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032484.4-2068s21c1
Sequence:CCGGAGGACACTGCTAGAGAGTTACCTCGAGGTAACTCTCTAGCAGTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032484.4-1424s21c1
Sequence:CCGGATATTGGTGAAGACCTGTTCTCTCGAGAGAACAGGTCTTCACCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032484.4-2160s21c1
Sequence:CCGGAGTGCACTGGGCAAGCTAGAACTCGAGTTCTAGCTTGCCCAGTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032484
GHDC MISSION shRNA shRNA Plasmid DNA
GH3 domain containing
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032484.3-853s1c1
Sequence:CCGGCTAAACAAGGCCTACCCAGAACTCGAGTTCTGGGTAGGCCTTGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032484.3-699s1c1
Sequence:CCGGGAGCACAGACATAAGCACCTTCTCGAGAAGGTGCTTATGTCTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163804    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032484.3-2411s1c1
Sequence:CCGGGCAGCAACCCTGAGTCAATAACTCGAGTTATTGACTCAGGGTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158430    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032484.3-2463s1c1
Sequence:CCGGCAGGACAATTCTGAAGTGTATCTCGAGATACACTTCAGAATTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032484.3-1552s1c1
Sequence:CCGGGTTGGTGCCTACAATCAGTGTCTCGAGACACTGATTGTAGGCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032484.3-2485s1c1
Sequence:CCGGCTACATAAACTCTCAGAGGATCTCGAGATCCTCTGAGAGTTTATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032484.3-723s1c1
Sequence:CCGGGAATCATCTCCCTCTGACCAACTCGAGTTGGTCAGAGGGAGATGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032484.3-695s1c1
Sequence:CCGGGAAGGAGCACAGACATAAGCACTCGAGTGCTTATGTCTGTGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032484.4-2068s21c1
Sequence:CCGGAGGACACTGCTAGAGAGTTACCTCGAGGTAACTCTCTAGCAGTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032484.4-1424s21c1
Sequence:CCGGATATTGGTGAAGACCTGTTCTCTCGAGAGAACAGGTCTTCACCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032484.4-2160s21c1
Sequence:CCGGAGTGCACTGGGCAAGCTAGAACTCGAGTTCTAGCTTGCCCAGTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032484
GHDC MISSION shRNA Lentiviral Transduction Particles
GH3 domain containing
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032484.3-853s1c1
Sequence:CCGGCTAAACAAGGCCTACCCAGAACTCGAGTTCTGGGTAGGCCTTGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032484.3-699s1c1
Sequence:CCGGGAGCACAGACATAAGCACCTTCTCGAGAAGGTGCTTATGTCTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163804    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032484.3-2411s1c1
Sequence:CCGGGCAGCAACCCTGAGTCAATAACTCGAGTTATTGACTCAGGGTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158430    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032484.3-2463s1c1
Sequence:CCGGCAGGACAATTCTGAAGTGTATCTCGAGATACACTTCAGAATTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032484.3-1552s1c1
Sequence:CCGGGTTGGTGCCTACAATCAGTGTCTCGAGACACTGATTGTAGGCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032484.3-2485s1c1
Sequence:CCGGCTACATAAACTCTCAGAGGATCTCGAGATCCTCTGAGAGTTTATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032484.3-723s1c1
Sequence:CCGGGAATCATCTCCCTCTGACCAACTCGAGTTGGTCAGAGGGAGATGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032484.3-695s1c1
Sequence:CCGGGAAGGAGCACAGACATAAGCACTCGAGTGCTTATGTCTGTGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032484.4-2068s21c1
Sequence:CCGGAGGACACTGCTAGAGAGTTACCTCGAGGTAACTCTCTAGCAGTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032484.4-1424s21c1
Sequence:CCGGATATTGGTGAAGACCTGTTCTCTCGAGAGAACAGGTCTTCACCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032484.4-2160s21c1
Sequence:CCGGAGTGCACTGGGCAAGCTAGAACTCGAGTTCTAGCTTGCCCAGTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031871
GHDC MISSION shRNA Bacterial Glycerol Stock
GH3 domain containing
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031871.1-1278s1c1
Sequence:CCGGGAAGTTACTGATGAGACTGTACTCGAGTACAGTCTCATCAGTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031871.1-1269s1c1
Sequence:CCGGGTTCGAGGAGAAGTTACTGATCTCGAGATCAGTAACTTCTCCTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031871.1-360s1c1
Sequence:CCGGGATATGAGAACCTTCCGGAATCTCGAGATTCCGGAAGGTTCTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031871.1-259s21c1
Sequence:CCGGTAGACCGGAGCACGTTGAATGCTCGAGCATTCAACGTGCTCCGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031871.1-484s21c1
Sequence:CCGGCCACCCTGCTGGGTCTAATAACTCGAGTTATTAGACCCAGCAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031871.1-1781s21c1
Sequence:CCGGTGGTCTGATTGGGTCCAATTGCTCGAGCAATTGGACCCAATCAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031871.1-1280s21c1
Sequence:CCGGAGTTACTGATGAGACTGTATTCTCGAGAATACAGTCTCATCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031871.1-649s21c1
Sequence:CCGGTGCTGCTGGAGGCATTGATATCTCGAGATATCAATGCCTCCAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031871
GHDC MISSION shRNA shRNA Plasmid DNA
GH3 domain containing
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031871.1-1278s1c1
Sequence:CCGGGAAGTTACTGATGAGACTGTACTCGAGTACAGTCTCATCAGTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031871.1-1269s1c1
Sequence:CCGGGTTCGAGGAGAAGTTACTGATCTCGAGATCAGTAACTTCTCCTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031871.1-360s1c1
Sequence:CCGGGATATGAGAACCTTCCGGAATCTCGAGATTCCGGAAGGTTCTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031871.1-259s21c1
Sequence:CCGGTAGACCGGAGCACGTTGAATGCTCGAGCATTCAACGTGCTCCGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031871.1-484s21c1
Sequence:CCGGCCACCCTGCTGGGTCTAATAACTCGAGTTATTAGACCCAGCAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031871.1-1781s21c1
Sequence:CCGGTGGTCTGATTGGGTCCAATTGCTCGAGCAATTGGACCCAATCAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031871.1-1280s21c1
Sequence:CCGGAGTTACTGATGAGACTGTATTCTCGAGAATACAGTCTCATCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031871.1-649s21c1
Sequence:CCGGTGCTGCTGGAGGCATTGATATCTCGAGATATCAATGCCTCCAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031871
GHDC MISSION shRNA Lentiviral Transduction Particles
GH3 domain containing
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031871.1-1278s1c1
Sequence:CCGGGAAGTTACTGATGAGACTGTACTCGAGTACAGTCTCATCAGTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031871.1-1269s1c1
Sequence:CCGGGTTCGAGGAGAAGTTACTGATCTCGAGATCAGTAACTTCTCCTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031871.1-360s1c1
Sequence:CCGGGATATGAGAACCTTCCGGAATCTCGAGATTCCGGAAGGTTCTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031871.1-259s21c1
Sequence:CCGGTAGACCGGAGCACGTTGAATGCTCGAGCATTCAACGTGCTCCGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031871.1-484s21c1
Sequence:CCGGCCACCCTGCTGGGTCTAATAACTCGAGTTATTAGACCCAGCAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031871.1-1781s21c1
Sequence:CCGGTGGTCTGATTGGGTCCAATTGCTCGAGCAATTGGACCCAATCAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031871.1-1280s21c1
Sequence:CCGGAGTTACTGATGAGACTGTATTCTCGAGAATACAGTCTCATCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031871.1-649s21c1
Sequence:CCGGTGCTGCTGGAGGCATTGATATCTCGAGATATCAATGCCTCCAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks