EMAIL THIS PAGE TO A FRIEND

GHITM

growth hormone inducible transmembrane protein

83 Gene Product Result for
Synonyms: DERP2 HSPC282 MICS1 PTD010 TMBIM5
UniProtKB ID: Q9H3K2, A8K9Z9, D3DWE0, O95894, Q5VT95, Q9H0P2
Gene ID:
Mouse(66092) growth hormone inducible transmembrane protein
Rat(290596) growth hormone inducible transmembrane protein
Zebrafish(393563) growth hormone inducible transmembrane protein
cow(100139659) growth hormone inducible transmembrane protein-like
cow(404143) growth hormone inducible transmembrane protein
chicken(423621) growth hormone inducible transmembrane protein
dog(479266) growth hormone inducible transmembrane protein
Horse(100052687) growth hormone inducible transmembrane protein
domestic cat(101082521) growth hormone inducible transmembrane protein
Goat(100860799) growth hormone inducible transmembrane protein
sheep(101110024) growth hormone inducible transmembrane protein
domestic guinea pig(100727289) growth hormone inducible transmembrane protein
naked mole-rat(101707463) growth hormone inducible transmembrane protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_078478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_078478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_078478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014394 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014394 Rosetta Predictions human pricing
NM_001005908 Rosetta Predictions rat pricing
NM_078478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196210 predicted 302
2 SASI_Hs01_00196212 predicted 763
3 SASI_Hs02_00345577 predicted 1269
4 SASI_Hs01_00196213 predicted 564
5 SASI_Hs02_00345578 predicted 895
6 SASI_Hs02_00345579 predicted 1078
7 SASI_Hs01_00196216 predicted 1063
8 SASI_Hs01_00196217 predicted 1021
9 SASI_Hs02_00345580 predicted 272
10 SASI_Hs01_00196219 predicted 1167
11 SASI_Hs01_00196211 predicted 449
12 SASI_Hs01_00196214 predicted 533
13 SASI_Hs01_00196215 predicted 991
14 SASI_Hs01_00196218 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075671 predicted 494
2 SASI_Rn01_00075672 predicted 229
3 SASI_Rn01_00075673 predicted 994
4 SASI_Rn01_00075676 predicted 522
5 SASI_Rn01_00075677 predicted 1011
6 SASI_Rn02_00198495 predicted 989
7 SASI_Rn01_00075678 predicted 1092
8 SASI_Rn01_00075679 predicted 1144
9 SASI_Rn02_00198496 predicted 840
10 SASI_Rn02_00198497 predicted 841
11 SASI_Rn01_00075670 predicted 591
12 SASI_Rn01_00075674 predicted 540
13 SASI_Rn01_00075675 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038332 predicted 428
2 SASI_Mm02_00338069 predicted 505
3 SASI_Mm01_00038335 predicted 557
4 SASI_Mm01_00038336 predicted 500
5 SASI_Mm01_00038337 predicted 619
6 SASI_Mm01_00038338 predicted 214
7 SASI_Mm01_00038339 predicted 676
8 SASI_Mm01_00038341 predicted 822
9 SASI_Mm02_00338070 predicted 629
10 SASI_Mm02_00338071 predicted 774
11 SASI_Mm01_00038333 predicted 1208
12 SASI_Mm01_00038334 predicted 983
13 SASI_Mm01_00038340 predicted 772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_078478
VALIDATED
GHITM MISSION shRNA Bacterial Glycerol Stock
growth hormone inducible transmembrane protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078478.4-1075s21c1
Sequence:CCGGACAATCTACATGGATACATTACTCGAGTAATGTATCCATGTAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078478.4-1190s21c1
Sequence:CCGGGCTTGTTTAATAGGAGCAGATCTCGAGATCTGCTCCTATTAAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078478.4-1006s21c1
Sequence:CCGGGTAATCAAACGTGCAGAAATACTCGAGTATTTCTGCACGTTTGATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078478.4-212s21c1
Sequence:CCGGCAAAGAACCAATGGCTCGTAACTCGAGTTACGAGCCATTGGTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_078478.1-212s1c1
Sequence:CCGGCAAAGAACCAATGGCTCGTAACTCGAGTTACGAGCCATTGGTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_078478.1-1190s1c1
Sequence:CCGGGCTTGTTTAATAGGAGCAGATCTCGAGATCTGCTCCTATTAAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_078478.1-1604s1c1
Sequence:CCGGCCAGTGAAAGACATCAGAGATCTCGAGATCTCTGATGTCTTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078478.1-1006s1c1
Sequence:CCGGGTAATCAAACGTGCAGAAATACTCGAGTATTTCTGCACGTTTGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078478.1-1057s1c2
Sequence:CCGGCCCATCAATTCGATGTTGACACTCGAGTGTCAACATCGAATTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_078478
VALIDATED
GHITM MISSION shRNA shRNA Plasmid DNA
growth hormone inducible transmembrane protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078478.4-1075s21c1
Sequence:CCGGACAATCTACATGGATACATTACTCGAGTAATGTATCCATGTAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078478.4-1190s21c1
Sequence:CCGGGCTTGTTTAATAGGAGCAGATCTCGAGATCTGCTCCTATTAAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078478.4-1006s21c1
Sequence:CCGGGTAATCAAACGTGCAGAAATACTCGAGTATTTCTGCACGTTTGATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078478.4-212s21c1
Sequence:CCGGCAAAGAACCAATGGCTCGTAACTCGAGTTACGAGCCATTGGTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_078478.1-212s1c1
Sequence:CCGGCAAAGAACCAATGGCTCGTAACTCGAGTTACGAGCCATTGGTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_078478.1-1190s1c1
Sequence:CCGGGCTTGTTTAATAGGAGCAGATCTCGAGATCTGCTCCTATTAAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_078478.1-1604s1c1
Sequence:CCGGCCAGTGAAAGACATCAGAGATCTCGAGATCTCTGATGTCTTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078478.1-1006s1c1
Sequence:CCGGGTAATCAAACGTGCAGAAATACTCGAGTATTTCTGCACGTTTGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078478.1-1057s1c2
Sequence:CCGGCCCATCAATTCGATGTTGACACTCGAGTGTCAACATCGAATTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_078478
VALIDATED
GHITM MISSION shRNA Lentiviral Transduction Particles
growth hormone inducible transmembrane protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078478.4-1075s21c1
Sequence:CCGGACAATCTACATGGATACATTACTCGAGTAATGTATCCATGTAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078478.4-1190s21c1
Sequence:CCGGGCTTGTTTAATAGGAGCAGATCTCGAGATCTGCTCCTATTAAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078478.4-1006s21c1
Sequence:CCGGGTAATCAAACGTGCAGAAATACTCGAGTATTTCTGCACGTTTGATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078478.4-212s21c1
Sequence:CCGGCAAAGAACCAATGGCTCGTAACTCGAGTTACGAGCCATTGGTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_078478.1-212s1c1
Sequence:CCGGCAAAGAACCAATGGCTCGTAACTCGAGTTACGAGCCATTGGTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_078478.1-1190s1c1
Sequence:CCGGGCTTGTTTAATAGGAGCAGATCTCGAGATCTGCTCCTATTAAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_078478.1-1604s1c1
Sequence:CCGGCCAGTGAAAGACATCAGAGATCTCGAGATCTCTGATGTCTTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078478.1-1006s1c1
Sequence:CCGGGTAATCAAACGTGCAGAAATACTCGAGTATTTCTGCACGTTTGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078478.1-1057s1c2
Sequence:CCGGCCCATCAATTCGATGTTGACACTCGAGTGTCAACATCGAATTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014394
VALIDATED
GHITM MISSION shRNA Bacterial Glycerol Stock
growth hormone inducible transmembrane protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014394.2-1036s21c1
Sequence:CCGGGTGGCAATGTACGGTGGATTACTCGAGTAATCCACCGTACATTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014394.2-1108s21c1
Sequence:CCGGGCAGAAGTATCACCAATGTATCTCGAGATACATTGGTGATACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014394.2-1583s21c1
Sequence:CCGGGCAAACCTGTGTTTGCATATTCTCGAGAATATGCAAACACAGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014394.2-1423s21c1
Sequence:CCGGGCAGTAATCCTCTCCCAAATACTCGAGTATTTGGGAGAGGATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014394.1-429s1c1
Sequence:CCGGCTTGGGACTGTCTAATGAGATCTCGAGATCTCATTAGACAGTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014394.1-1000s1c1
Sequence:CCGGCTTCTGTATGATACCCAGAAACTCGAGTTTCTGGGTATCATACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151131    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014394.1-1507s1c1
Sequence:CCGGGCAAACCTGTGTTTGCATATTCTCGAGAATATGCAAACACAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014394.1-1032s1c1
Sequence:CCGGGCAGAAGTATCACCAATGTATCTCGAGATACATTGGTGATACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014394.1-1347s1c1
Sequence:CCGGGCAGTAATCCTCTCCCAAATACTCGAGTATTTGGGAGAGGATTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014394.1-1017s1c1
Sequence:CCGGGAAAGTATCAAGCGTGCAGAACTCGAGTTCTGCACGCTTGATACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014394.1-961s1c1
Sequence:CCGGGTGGCAATGTACGGTGGATTACTCGAGTAATCCACCGTACATTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014394
VALIDATED
GHITM MISSION shRNA shRNA Plasmid DNA
growth hormone inducible transmembrane protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014394.2-1036s21c1
Sequence:CCGGGTGGCAATGTACGGTGGATTACTCGAGTAATCCACCGTACATTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014394.2-1108s21c1
Sequence:CCGGGCAGAAGTATCACCAATGTATCTCGAGATACATTGGTGATACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014394.2-1583s21c1
Sequence:CCGGGCAAACCTGTGTTTGCATATTCTCGAGAATATGCAAACACAGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014394.2-1423s21c1
Sequence:CCGGGCAGTAATCCTCTCCCAAATACTCGAGTATTTGGGAGAGGATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014394.1-429s1c1
Sequence:CCGGCTTGGGACTGTCTAATGAGATCTCGAGATCTCATTAGACAGTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014394.1-1000s1c1
Sequence:CCGGCTTCTGTATGATACCCAGAAACTCGAGTTTCTGGGTATCATACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151131    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014394.1-1507s1c1
Sequence:CCGGGCAAACCTGTGTTTGCATATTCTCGAGAATATGCAAACACAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014394.1-1032s1c1
Sequence:CCGGGCAGAAGTATCACCAATGTATCTCGAGATACATTGGTGATACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014394.1-1347s1c1
Sequence:CCGGGCAGTAATCCTCTCCCAAATACTCGAGTATTTGGGAGAGGATTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014394.1-1017s1c1
Sequence:CCGGGAAAGTATCAAGCGTGCAGAACTCGAGTTCTGCACGCTTGATACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014394.1-961s1c1
Sequence:CCGGGTGGCAATGTACGGTGGATTACTCGAGTAATCCACCGTACATTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014394
VALIDATED
GHITM MISSION shRNA Lentiviral Transduction Particles
growth hormone inducible transmembrane protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014394.2-1036s21c1
Sequence:CCGGGTGGCAATGTACGGTGGATTACTCGAGTAATCCACCGTACATTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014394.2-1108s21c1
Sequence:CCGGGCAGAAGTATCACCAATGTATCTCGAGATACATTGGTGATACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014394.2-1583s21c1
Sequence:CCGGGCAAACCTGTGTTTGCATATTCTCGAGAATATGCAAACACAGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014394.2-1423s21c1
Sequence:CCGGGCAGTAATCCTCTCCCAAATACTCGAGTATTTGGGAGAGGATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014394.1-429s1c1
Sequence:CCGGCTTGGGACTGTCTAATGAGATCTCGAGATCTCATTAGACAGTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014394.1-1000s1c1
Sequence:CCGGCTTCTGTATGATACCCAGAAACTCGAGTTTCTGGGTATCATACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151131    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014394.1-1507s1c1
Sequence:CCGGGCAAACCTGTGTTTGCATATTCTCGAGAATATGCAAACACAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014394.1-1032s1c1
Sequence:CCGGGCAGAAGTATCACCAATGTATCTCGAGATACATTGGTGATACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014394.1-1347s1c1
Sequence:CCGGGCAGTAATCCTCTCCCAAATACTCGAGTATTTGGGAGAGGATTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014394.1-1017s1c1
Sequence:CCGGGAAAGTATCAAGCGTGCAGAACTCGAGTTCTGCACGCTTGATACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014394.1-961s1c1
Sequence:CCGGGTGGCAATGTACGGTGGATTACTCGAGTAATCCACCGTACATTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks