EMAIL THIS PAGE TO A FRIEND

GHR

growth hormone receptor

166 Gene Product Result for
Synonyms: GHBP
UniProtKB ID: P10912, Q9HCX2
Gene ID:
Human(2690) Summary: This gene encodes a member of the type I cytokine receptor family, which is a transmembrane receptor for growth hormone. Binding of growth hormone to the receptor leads to receptor dimerization and the activation of an intra- and intercellular signal transduction pathway leading to growth. Mutations in this gene have been associated with Laron syndrome, also known as the growth hormone insensitivity syndrome (GHIS), a disorder characterized by short stature. In humans and rabbits, but not rodents, growth hormone binding protein (GHBP) is generated by proteolytic cleavage of the extracellular ligand-binding domain from the mature growth hormone receptor protein. Multiple alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jun 2011]
Mouse(14600) growth hormone receptor
Rat(25235) growth hormone receptor
chicken(408184) growth hormone receptor
cow(280805) growth hormone receptor
domestic cat(101093244) growth hormone receptor
dog(403721) growth hormone receptor
naked mole-rat(101716037) growth hormone receptor
domestic guinea pig(100135527) growth hormone receptor
Goat(100860790) growth hormone receptor
Domestic Rabbit(100009325) growth hormone receptor
sheep(443333) growth hormone receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000163 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010284 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010284 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010284 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000163 Rosetta Predictions human pricing
NM_017094 Rosetta Predictions rat pricing
NM_001048147 Rosetta Predictions mouse pricing
NM_001048178 Rosetta Predictions mouse pricing
NM_010284 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144249 predicted 531
2 SASI_Hs01_00144250 predicted 525
3 SASI_Hs01_00144251 predicted 1080
4 SASI_Hs01_00144252 predicted 1817
5 SASI_Hs01_00144253 predicted 1454
6 SASI_Hs01_00144255 predicted 1147
7 SASI_Hs02_00301988 predicted 1050
8 SASI_Hs01_00144256 predicted 1467
9 SASI_Hs02_00301989 predicted 1025
10 SASI_Hs02_00301990 predicted 854
11 SASI_Hs01_00144247 predicted 1054
12 SASI_Hs01_00144248 predicted 1021
13 SASI_Hs01_00144254 predicted 1705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091011 predicted 475
2 SASI_Rn01_00091012 predicted 1521
3 SASI_Rn01_00091013 predicted 741
4 SASI_Rn01_00091014 predicted 427
5 SASI_Rn01_00091015 predicted 876
6 SASI_Rn01_00091016 predicted 643
7 SASI_Rn01_00091017 predicted 530
8 SASI_Rn01_00091018 predicted 920
9 SASI_Rn01_00091019 predicted 582
10 SASI_Rn01_00091020 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292071 predicted 411
2 SASI_Mm02_00292072 predicted 330
3 SASI_Mm02_00292073 predicted 332
4 SASI_Mm02_00292074 predicted 674
5 SASI_Mm02_00292075 predicted 577
6 SASI_Mm02_00292076 predicted 446
7 SASI_Mm02_00292077 predicted 679
8 SASI_Mm02_00292078 predicted 301
9 SASI_Mm02_00292079 predicted 730
10 SASI_Mm02_00292080 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292140 predicted 549
2 SASI_Mm02_00292141 predicted 478
3 SASI_Mm02_00292142 predicted 523
4 SASI_Mm02_00292143 predicted 820
5 SASI_Mm02_00292144 predicted 726
6 SASI_Mm02_00292145 predicted 723
7 SASI_Mm02_00292146 predicted 597
8 SASI_Mm02_00292147 predicted 447
9 SASI_Mm02_00292148 predicted 703
10 SASI_Mm02_00292149 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010284 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176690 predicted 554
2 SASI_Mm01_00176691 predicted 478
3 SASI_Mm02_00318230 predicted 522
4 SASI_Mm01_00176694 predicted 818
5 SASI_Mm02_00318231 predicted 722
6 SASI_Mm01_00176695 predicted 717
7 SASI_Mm02_00318232 predicted 597
8 SASI_Mm01_00176696 predicted 445
9 SASI_Mm02_00318233 predicted 696
10 SASI_Mm02_00318234 predicted 790
11 SASI_Mm01_00176692 predicted 1024
12 SASI_Mm01_00176693 predicted 601
13 SASI_Mm01_00176697 predicted 1184
14 SASI_Mm01_00176698 predicted 872
15 SASI_Mm01_00176699 predicted 1857
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000163
GHR MISSION shRNA Bacterial Glycerol Stock
growth hormone receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000163.1-572s1c1
Sequence:CCGGGCACCACGCAATGCAGATATTCTCGAGAATATCTGCATTGCGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000163.1-1820s1c1
Sequence:CCGGCCAGACTATACCTCCATTCATCTCGAGATGAATGGAGGTATAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000163.1-1022s1c1
Sequence:CCGGGCCATTCATGATAGCTATAAACTCGAGTTTATAGCTATCATGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000163.1-1682s1c1
Sequence:CCGGGCTCCTCACATCAAGGTTGAACTCGAGTTCAACCTTGATGTGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000163.1-402s1c1
Sequence:CCGGCCATCTGGATACCTTATTGTACTCGAGTACAATAAGGTATCCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000163.2-1583s21c1
Sequence:CCGGTGTGACATGCACCCGGAAATGCTCGAGCATTTCCGGGTGCATGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000163.2-182s21c1
Sequence:CCGGTCTTCTAAGGAGCCTAAATTCCTCGAGGAATTTAGGCTCCTTAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000163.2-1443s21c1
Sequence:CCGGCTCACCAAGCTGCCCATATTCCTCGAGGAATATGGGCAGCTTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000163
GHR MISSION shRNA shRNA Plasmid DNA
growth hormone receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000163.1-572s1c1
Sequence:CCGGGCACCACGCAATGCAGATATTCTCGAGAATATCTGCATTGCGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000163.1-1820s1c1
Sequence:CCGGCCAGACTATACCTCCATTCATCTCGAGATGAATGGAGGTATAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000163.1-1022s1c1
Sequence:CCGGGCCATTCATGATAGCTATAAACTCGAGTTTATAGCTATCATGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000163.1-1682s1c1
Sequence:CCGGGCTCCTCACATCAAGGTTGAACTCGAGTTCAACCTTGATGTGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000163.1-402s1c1
Sequence:CCGGCCATCTGGATACCTTATTGTACTCGAGTACAATAAGGTATCCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000163.2-1583s21c1
Sequence:CCGGTGTGACATGCACCCGGAAATGCTCGAGCATTTCCGGGTGCATGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000163.2-182s21c1
Sequence:CCGGTCTTCTAAGGAGCCTAAATTCCTCGAGGAATTTAGGCTCCTTAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000163.2-1443s21c1
Sequence:CCGGCTCACCAAGCTGCCCATATTCCTCGAGGAATATGGGCAGCTTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000163
GHR MISSION shRNA Lentiviral Transduction Particles
growth hormone receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000163.1-572s1c1
Sequence:CCGGGCACCACGCAATGCAGATATTCTCGAGAATATCTGCATTGCGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000163.1-1820s1c1
Sequence:CCGGCCAGACTATACCTCCATTCATCTCGAGATGAATGGAGGTATAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000163.1-1022s1c1
Sequence:CCGGGCCATTCATGATAGCTATAAACTCGAGTTTATAGCTATCATGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000163.1-1682s1c1
Sequence:CCGGGCTCCTCACATCAAGGTTGAACTCGAGTTCAACCTTGATGTGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000163.1-402s1c1
Sequence:CCGGCCATCTGGATACCTTATTGTACTCGAGTACAATAAGGTATCCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000163.2-1583s21c1
Sequence:CCGGTGTGACATGCACCCGGAAATGCTCGAGCATTTCCGGGTGCATGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000163.2-182s21c1
Sequence:CCGGTCTTCTAAGGAGCCTAAATTCCTCGAGGAATTTAGGCTCCTTAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000163.2-1443s21c1
Sequence:CCGGCTCACCAAGCTGCCCATATTCCTCGAGGAATATGGGCAGCTTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010284
VALIDATED
GHR MISSION shRNA Bacterial Glycerol Stock
growth hormone receptor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010284.1-1266s1c1
Sequence:CCGGCCCGACTTCTACAATGATGATCTCGAGATCATCATTGTAGAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010284.1-1948s1c1
Sequence:CCGGGCTTTAACCAAGAGGACATTTCTCGAGAAATGTCCTCTTGGTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010284.1-1704s1c1
Sequence:CCGGCCCACATCACTGGCAAACATTCTCGAGAATGTTTGCCAGTGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010284.1-522s1c1
Sequence:CCGGGCTGCAAGAATTGCTCATGAACTCGAGTTCATGAGCAATTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010284.1-2109s1c1
Sequence:CCGGGCTTTGCCTTTGCCTGACAAACTCGAGTTTGTCAGGCAAAGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010284.2-523s21c1
Sequence:CCGGGCTGCAAGAATTGCTCATGAACTCGAGTTCATGAGCAATTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010284.2-1267s21c1
Sequence:CCGGCCCGACTTCTACAATGATGATCTCGAGATCATCATTGTAGAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010284.2-2545s21c1
Sequence:CCGGGAAATTGAATGCAGATTATAGCTCGAGCTATAATCTGCATTCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010284.2-993s21c1
Sequence:CCGGCAGCGAAGTCCTCCGTGTAATCTCGAGATTACACGGAGGACTTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010284.2-1733s21c1
Sequence:CCGGATGCCCAAGTAAGCGACATTACTCGAGTAATGTCGCTTACTTGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010284
VALIDATED
GHR MISSION shRNA shRNA Plasmid DNA
growth hormone receptor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010284.1-1266s1c1
Sequence:CCGGCCCGACTTCTACAATGATGATCTCGAGATCATCATTGTAGAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010284.1-1948s1c1
Sequence:CCGGGCTTTAACCAAGAGGACATTTCTCGAGAAATGTCCTCTTGGTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010284.1-1704s1c1
Sequence:CCGGCCCACATCACTGGCAAACATTCTCGAGAATGTTTGCCAGTGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010284.1-522s1c1
Sequence:CCGGGCTGCAAGAATTGCTCATGAACTCGAGTTCATGAGCAATTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010284.1-2109s1c1
Sequence:CCGGGCTTTGCCTTTGCCTGACAAACTCGAGTTTGTCAGGCAAAGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010284.2-523s21c1
Sequence:CCGGGCTGCAAGAATTGCTCATGAACTCGAGTTCATGAGCAATTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010284.2-1267s21c1
Sequence:CCGGCCCGACTTCTACAATGATGATCTCGAGATCATCATTGTAGAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010284.2-2545s21c1
Sequence:CCGGGAAATTGAATGCAGATTATAGCTCGAGCTATAATCTGCATTCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010284.2-993s21c1
Sequence:CCGGCAGCGAAGTCCTCCGTGTAATCTCGAGATTACACGGAGGACTTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010284.2-1733s21c1
Sequence:CCGGATGCCCAAGTAAGCGACATTACTCGAGTAATGTCGCTTACTTGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010284
VALIDATED
GHR MISSION shRNA Lentiviral Transduction Particles
growth hormone receptor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010284.1-1266s1c1
Sequence:CCGGCCCGACTTCTACAATGATGATCTCGAGATCATCATTGTAGAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010284.1-1948s1c1
Sequence:CCGGGCTTTAACCAAGAGGACATTTCTCGAGAAATGTCCTCTTGGTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010284.1-1704s1c1
Sequence:CCGGCCCACATCACTGGCAAACATTCTCGAGAATGTTTGCCAGTGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010284.1-522s1c1
Sequence:CCGGGCTGCAAGAATTGCTCATGAACTCGAGTTCATGAGCAATTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010284.1-2109s1c1
Sequence:CCGGGCTTTGCCTTTGCCTGACAAACTCGAGTTTGTCAGGCAAAGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010284.2-523s21c1
Sequence:CCGGGCTGCAAGAATTGCTCATGAACTCGAGTTCATGAGCAATTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010284.2-1267s21c1
Sequence:CCGGCCCGACTTCTACAATGATGATCTCGAGATCATCATTGTAGAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010284.2-2545s21c1
Sequence:CCGGGAAATTGAATGCAGATTATAGCTCGAGCTATAATCTGCATTCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010284.2-993s21c1
Sequence:CCGGCAGCGAAGTCCTCCGTGTAATCTCGAGATTACACGGAGGACTTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010284.2-1733s21c1
Sequence:CCGGATGCCCAAGTAAGCGACATTACTCGAGTAATGTCGCTTACTTGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks