EMAIL THIS PAGE TO A FRIEND

GHRH

growth hormone releasing hormone

64 Gene Product Result for
Synonyms: GHRF GRF INN
UniProtKB ID: P01286, Q4KN10, Q5JYR1
Gene ID:
Human(2691) Summary: The protein encoded by this gene belongs to the glucagon family and is a preproprotein that is produced in the hypothalamus. The preproprotein is cleaved to form a 44 aa factor, also called somatocrinin, that acts to stimulate growth hormone release from the pituitary. Variant receptors for somatocrinin have been found in several types of tumors, and antagonists of these receptors can inhibit the growth of the tumors. Defects in this gene are a cause of dwarfism, while hypersecretion of the encoded protein is a cause of gigantism. [provided by RefSeq, Jul 2008]
Mouse(14601) growth hormone releasing hormone
Rat(29446) growth hormone releasing hormone
Zebrafish(791105) growth hormone releasing hormone
chicken(419178) growth hormone releasing hormone
dog(485863) growth hormone releasing hormone
cow(281191) growth hormone releasing hormone
domestic cat(101101046) growth hormone releasing hormone
domestic guinea pig(100736008) growth hormone releasing hormone
naked mole-rat(101703645) growth hormone releasing hormone
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010285 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010285 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010285 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021081 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021081 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021081 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021081 Rosetta Predictions human pricing
NM_031577 Rosetta Predictions rat pricing
NM_010285 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021060 predicted 200
2 SASI_Hs01_00021061 predicted 218
3 SASI_Hs01_00021062 predicted 209
4 SASI_Hs01_00021063 predicted 214
5 SASI_Hs01_00021064 predicted 212
6 SASI_Hs01_00021065 predicted 213
7 SASI_Hs01_00021066 predicted 225
8 SASI_Hs01_00021067 predicted 219
9 SASI_Hs01_00021068 predicted 227
10 SASI_Hs01_00021069 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076185 predicted 338
2 SASI_Rn01_00076186 predicted 311
3 SASI_Rn01_00076187 predicted 381
4 SASI_Rn01_00076188 predicted 334
5 SASI_Rn01_00076189 predicted 313
6 SASI_Rn01_00076190 predicted 314
7 SASI_Rn01_00076191 predicted 272
8 SASI_Rn01_00076192 predicted 279
9 SASI_Rn01_00076193 predicted 278
10 SASI_Rn02_00264840 predicted 337
11 SASI_Rn01_00076194 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010285 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114123 predicted 244
2 SASI_Mm02_00318235 predicted 255
3 SASI_Mm02_00318236 predicted 195
4 SASI_Mm02_00318237 predicted 257
5 SASI_Mm02_00318238 predicted 254
6 SASI_Mm01_00114127 predicted 233
7 SASI_Mm02_00318239 predicted 202
8 SASI_Mm01_00114129 predicted 238
9 SASI_Mm02_00318240 predicted 221
10 SASI_Mm02_00318241 predicted 217
11 SASI_Mm01_00114120 predicted 412
12 SASI_Mm01_00114121 predicted 313
13 SASI_Mm01_00114122 predicted 265
14 SASI_Mm01_00114124 predicted 233
15 SASI_Mm01_00114125 predicted 241
16 SASI_Mm01_00114126 predicted 226
17 SASI_Mm01_00114128 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010285
GHRH MISSION shRNA Bacterial Glycerol Stock
growth hormone releasing hormone
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010285.2-194s21c1
Sequence:CCGGACACGTAGATGCCATCTTCACCTCGAGGTGAAGATGGCATCTACGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010285.2-183s21c1
Sequence:CCGGAGGATGCAGCGACACGTAGATCTCGAGATCTACGTGTCGCTGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010285.2-368s21c1
Sequence:CCGGGAGCATCTTGCAGGGATTCCCCTCGAGGGGAATCCCTGCAAGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010285.1-329s1c1
Sequence:CCGGCTTCACCACCAACTACAGGAACTCGAGTTCCTGTAGTTGGTGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010285.1-325s1c1
Sequence:CCGGCCATCTTCACCACCAACTACACTCGAGTGTAGTTGGTGGTGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010285.1-374s1c1
Sequence:CCGGGAAAGTGATCCAGGACATCATCTCGAGATGATGTCCTGGATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010285.1-384s1c1
Sequence:CCGGCAGGACATCATGAACAAGCAACTCGAGTTGCTTGTTCATGATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010285.1-378s1c1
Sequence:CCGGGTGATCCAGGACATCATGAACCTCGAGGTTCATGATGTCCTGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010285
GHRH MISSION shRNA shRNA Plasmid DNA
growth hormone releasing hormone
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010285.2-194s21c1
Sequence:CCGGACACGTAGATGCCATCTTCACCTCGAGGTGAAGATGGCATCTACGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010285.2-183s21c1
Sequence:CCGGAGGATGCAGCGACACGTAGATCTCGAGATCTACGTGTCGCTGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010285.2-368s21c1
Sequence:CCGGGAGCATCTTGCAGGGATTCCCCTCGAGGGGAATCCCTGCAAGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010285.1-329s1c1
Sequence:CCGGCTTCACCACCAACTACAGGAACTCGAGTTCCTGTAGTTGGTGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010285.1-325s1c1
Sequence:CCGGCCATCTTCACCACCAACTACACTCGAGTGTAGTTGGTGGTGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010285.1-374s1c1
Sequence:CCGGGAAAGTGATCCAGGACATCATCTCGAGATGATGTCCTGGATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010285.1-384s1c1
Sequence:CCGGCAGGACATCATGAACAAGCAACTCGAGTTGCTTGTTCATGATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010285.1-378s1c1
Sequence:CCGGGTGATCCAGGACATCATGAACCTCGAGGTTCATGATGTCCTGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010285
GHRH MISSION shRNA Lentiviral Transduction Particles
growth hormone releasing hormone
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010285.2-194s21c1
Sequence:CCGGACACGTAGATGCCATCTTCACCTCGAGGTGAAGATGGCATCTACGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010285.2-183s21c1
Sequence:CCGGAGGATGCAGCGACACGTAGATCTCGAGATCTACGTGTCGCTGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010285.2-368s21c1
Sequence:CCGGGAGCATCTTGCAGGGATTCCCCTCGAGGGGAATCCCTGCAAGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010285.1-329s1c1
Sequence:CCGGCTTCACCACCAACTACAGGAACTCGAGTTCCTGTAGTTGGTGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010285.1-325s1c1
Sequence:CCGGCCATCTTCACCACCAACTACACTCGAGTGTAGTTGGTGGTGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010285.1-374s1c1
Sequence:CCGGGAAAGTGATCCAGGACATCATCTCGAGATGATGTCCTGGATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010285.1-384s1c1
Sequence:CCGGCAGGACATCATGAACAAGCAACTCGAGTTGCTTGTTCATGATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010285.1-378s1c1
Sequence:CCGGGTGATCCAGGACATCATGAACCTCGAGGTTCATGATGTCCTGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021081
GHRH MISSION shRNA Bacterial Glycerol Stock
growth hormone releasing hormone
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021081.3-227s21c1
Sequence:CCGGGTCGTCAGGTAGACAGCATGTCTCGAGACATGCTGTCTACCTGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021081.3-103s21c1
Sequence:CCGGGCCATCTTCACCAACAGCTACCTCGAGGTAGCTGTTGGTGAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021081.3-219s21c1
Sequence:CCGGACGGCTTGGTCGTCAGGTAGACTCGAGTCTACCTGACGACCAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021081.3-182s21c1
Sequence:CCGGAGCAGGGAGAGAGCAACCAAGCTCGAGCTTGGTTGCTCTCTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021081.3-261s1c1
Sequence:CCGGGCAAATGGAATTGGAGAGCATCTCGAGATGCTCTCCAATTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021081.3-205s1c1
Sequence:CCGGCGAGGAGCAAGGGCACGGCTTCTCGAGAAGCCGTGCCCTTGCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021081.3-90s1c1
Sequence:CCGGGCGGTATGCAGATGCCATCTTCTCGAGAAGATGGCATCTGCATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021081.3-111s1c1
Sequence:CCGGCACCAACAGCTACCGGAAGGTCTCGAGACCTTCCGGTAGCTGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021081.3-235s1c1
Sequence:CCGGGTAGACAGCATGTGGGCAGAACTCGAGTTCTGCCCACATGCTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021081
GHRH MISSION shRNA shRNA Plasmid DNA
growth hormone releasing hormone
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021081.3-227s21c1
Sequence:CCGGGTCGTCAGGTAGACAGCATGTCTCGAGACATGCTGTCTACCTGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021081.3-103s21c1
Sequence:CCGGGCCATCTTCACCAACAGCTACCTCGAGGTAGCTGTTGGTGAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021081.3-219s21c1
Sequence:CCGGACGGCTTGGTCGTCAGGTAGACTCGAGTCTACCTGACGACCAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021081.3-182s21c1
Sequence:CCGGAGCAGGGAGAGAGCAACCAAGCTCGAGCTTGGTTGCTCTCTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021081.3-261s1c1
Sequence:CCGGGCAAATGGAATTGGAGAGCATCTCGAGATGCTCTCCAATTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021081.3-205s1c1
Sequence:CCGGCGAGGAGCAAGGGCACGGCTTCTCGAGAAGCCGTGCCCTTGCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021081.3-90s1c1
Sequence:CCGGGCGGTATGCAGATGCCATCTTCTCGAGAAGATGGCATCTGCATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021081.3-111s1c1
Sequence:CCGGCACCAACAGCTACCGGAAGGTCTCGAGACCTTCCGGTAGCTGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021081.3-235s1c1
Sequence:CCGGGTAGACAGCATGTGGGCAGAACTCGAGTTCTGCCCACATGCTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021081
GHRH MISSION shRNA Lentiviral Transduction Particles
growth hormone releasing hormone
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021081.3-227s21c1
Sequence:CCGGGTCGTCAGGTAGACAGCATGTCTCGAGACATGCTGTCTACCTGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021081.3-103s21c1
Sequence:CCGGGCCATCTTCACCAACAGCTACCTCGAGGTAGCTGTTGGTGAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021081.3-219s21c1
Sequence:CCGGACGGCTTGGTCGTCAGGTAGACTCGAGTCTACCTGACGACCAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021081.3-182s21c1
Sequence:CCGGAGCAGGGAGAGAGCAACCAAGCTCGAGCTTGGTTGCTCTCTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021081.3-261s1c1
Sequence:CCGGGCAAATGGAATTGGAGAGCATCTCGAGATGCTCTCCAATTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021081.3-205s1c1
Sequence:CCGGCGAGGAGCAAGGGCACGGCTTCTCGAGAAGCCGTGCCCTTGCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021081.3-90s1c1
Sequence:CCGGGCGGTATGCAGATGCCATCTTCTCGAGAAGATGGCATCTGCATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021081.3-111s1c1
Sequence:CCGGCACCAACAGCTACCGGAAGGTCTCGAGACCTTCCGGTAGCTGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021081.3-235s1c1
Sequence:CCGGGTAGACAGCATGTGGGCAGAACTCGAGTTCTGCCCACATGCTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks