EMAIL THIS PAGE TO A FRIEND

GHRHR

growth hormone releasing hormone receptor

76 Gene Product Result for
Synonyms: GHRFR GRFR IGHD1B
UniProtKB ID: Q02643, Q99863
Gene ID:
Human(2692) Summary: This gene encodes a receptor for growth hormone-releasing hormone. Binding of this hormone to the receptor leads to synthesis and release of growth hormone. Mutations in this gene have been associated with isolated growth hormone deficiency (IGHD), also known as Dwarfism of Sindh, a disorder characterized by short stature. [provided by RefSeq, Jun 2010]
Mouse(14602) growth hormone releasing hormone receptor
Rat(25321) growth hormone releasing hormone receptor
chicken(420385) growth hormone releasing hormone receptor
cow(281782) growth hormone releasing hormone receptor
domestic cat(101088147) growth hormone releasing hormone receptor
dog(482385) growth hormone releasing hormone receptor
naked mole-rat(101713164) growth hormone releasing hormone receptor
domestic guinea pig(100724291) growth hormone releasing hormone receptor
sheep(443511) growth hormone releasing hormone receptor
Domestic Rabbit(100338654) growth hormone releasing hormone receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41859 Anti-GHRHR antibody produced in rabbit affinity isolated antibody rabbit, pig, guinea pig, canine, bovine, human, mouse, horse, sheep
western blot pricing
SAB2100915 Anti-GHRHR antibody produced in rabbit affinity isolated antibody pig, canine, rabbit, bovine, guinea pig, horse, sheep, human
western blot pricing
SAB2104859 Anti-GHRHR antibody produced in rabbit affinity isolated antibody rabbit, sheep, human, horse
western blot pricing
SAB4501169 Anti-GHRHR, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
G6771 Growth Hormone Releasing Factor Fragment 1-29 amide human ≥97% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000823 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000823 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000823 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_132546 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_132546 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_132546 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000823 Rosetta Predictions human pricing
NM_001009824 Rosetta Predictions human pricing
NM_012850 Rosetta Predictions rat pricing
NM_001003685 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170045 predicted 312
2 SASI_Hs01_00170046 predicted 717
3 SASI_Hs01_00170047 predicted 456
4 SASI_Hs01_00170048 predicted 274
5 SASI_Hs02_00303300 predicted 704
6 SASI_Hs01_00170049 predicted 453
7 SASI_Hs01_00170051 predicted 451
8 SASI_Hs01_00170052 predicted 353
9 SASI_Hs01_00170053 predicted 277
10 SASI_Hs01_00170054 predicted 417
11 SASI_Hs01_00170050 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165816 predicted 313
2 SASI_Hs01_00165817 predicted 721
3 SASI_Hs01_00165818 predicted 459
4 SASI_Hs01_00165819 predicted 279
5 SASI_Hs02_00305692 predicted 710
6 SASI_Hs01_00165820 predicted 449
7 SASI_Hs01_00165822 predicted 455
8 SASI_Hs01_00165823 predicted 356
9 SASI_Hs01_00165824 predicted 280
10 SASI_Hs01_00165825 predicted 412
11 SASI_Hs01_00165821 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055384 predicted 1374
2 SASI_Rn02_00260326 predicted 1018
3 SASI_Rn01_00055385 predicted 256
4 SASI_Rn01_00055386 predicted 1023
5 SASI_Rn01_00055387 predicted 259
6 SASI_Rn01_00055388 predicted 1035
7 SASI_Rn01_00055389 predicted 1002
8 SASI_Rn01_00055390 predicted 507
9 SASI_Rn01_00055391 predicted 1024
10 SASI_Rn01_00055392 predicted 1175
11 SASI_Rn01_00055393 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199053 predicted 979
2 SASI_Mm01_00199054 predicted 756
3 SASI_Mm02_00286325 predicted 1083
4 SASI_Mm01_00199055 predicted 1085
5 SASI_Mm01_00199057 predicted 1102
6 SASI_Mm02_00286326 predicted 1237
7 SASI_Mm02_00286327 predicted 1238
8 SASI_Mm01_00199059 predicted 389
9 SASI_Mm01_00199062 predicted 563
10 SASI_Mm02_00286328 predicted 322
11 SASI_Mm01_00199056 predicted 835
12 SASI_Mm01_00199058 predicted 310
13 SASI_Mm01_00199060 predicted 916
14 SASI_Mm01_00199061 predicted 795
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000823
GHRHR MISSION shRNA Bacterial Glycerol Stock
growth hormone releasing hormone receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000823.1-1350s1c1
Sequence:CCGGACACTTGAATTTGGGCAGCTACTCGAGTAGCTGCCCAAATTCAAGTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000823.1-285s1c1
Sequence:CCGGCCCGGATTTCTTCTCTCACTTCTCGAGAAGTGAGAGAAGAAATCCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000823.1-123s1c1
Sequence:CCGGGCACCCAGAATGTGACTTCATCTCGAGATGAAGTCACATTCTGGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000823.1-454s1c1
Sequence:CCGGGTGGGCCATAGCATCTCTATTCTCGAGAATAGAGATGCTATGGCCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000823.2-887s21c1
Sequence:CCGGCCTACTGGTGGATCATCAAAGCTCGAGCTTTGATGATCCACCAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000823.2-403s21c1
Sequence:CCGGCTGGCTGAGGAGGAATCTTACCTCGAGGTAAGATTCCTCCTCAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000823.2-322s21c1
Sequence:CCGGGTGAAACGGGATTGTACTATCCTCGAGGATAGTACAATCCCGTTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000823.2-1339s21c1
Sequence:CCGGTGGAGTCCACACTTGAATTTGCTCGAGCAAATTCAAGTGTGGACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000823
GHRHR MISSION shRNA shRNA Plasmid DNA
growth hormone releasing hormone receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000823.1-1350s1c1
Sequence:CCGGACACTTGAATTTGGGCAGCTACTCGAGTAGCTGCCCAAATTCAAGTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000823.1-285s1c1
Sequence:CCGGCCCGGATTTCTTCTCTCACTTCTCGAGAAGTGAGAGAAGAAATCCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000823.1-123s1c1
Sequence:CCGGGCACCCAGAATGTGACTTCATCTCGAGATGAAGTCACATTCTGGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000823.1-454s1c1
Sequence:CCGGGTGGGCCATAGCATCTCTATTCTCGAGAATAGAGATGCTATGGCCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000823.2-887s21c1
Sequence:CCGGCCTACTGGTGGATCATCAAAGCTCGAGCTTTGATGATCCACCAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000823.2-403s21c1
Sequence:CCGGCTGGCTGAGGAGGAATCTTACCTCGAGGTAAGATTCCTCCTCAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000823.2-322s21c1
Sequence:CCGGGTGAAACGGGATTGTACTATCCTCGAGGATAGTACAATCCCGTTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000823.2-1339s21c1
Sequence:CCGGTGGAGTCCACACTTGAATTTGCTCGAGCAAATTCAAGTGTGGACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000823
GHRHR MISSION shRNA Lentiviral Transduction Particles
growth hormone releasing hormone receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000823.1-1350s1c1
Sequence:CCGGACACTTGAATTTGGGCAGCTACTCGAGTAGCTGCCCAAATTCAAGTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000823.1-285s1c1
Sequence:CCGGCCCGGATTTCTTCTCTCACTTCTCGAGAAGTGAGAGAAGAAATCCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000823.1-123s1c1
Sequence:CCGGGCACCCAGAATGTGACTTCATCTCGAGATGAAGTCACATTCTGGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000823.1-454s1c1
Sequence:CCGGGTGGGCCATAGCATCTCTATTCTCGAGAATAGAGATGCTATGGCCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000823.2-887s21c1
Sequence:CCGGCCTACTGGTGGATCATCAAAGCTCGAGCTTTGATGATCCACCAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000823.2-403s21c1
Sequence:CCGGCTGGCTGAGGAGGAATCTTACCTCGAGGTAAGATTCCTCCTCAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000823.2-322s21c1
Sequence:CCGGGTGAAACGGGATTGTACTATCCTCGAGGATAGTACAATCCCGTTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000823.2-1339s21c1
Sequence:CCGGTGGAGTCCACACTTGAATTTGCTCGAGCAAATTCAAGTGTGGACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_132546
GHRHR MISSION shRNA Bacterial Glycerol Stock
growth hormone releasing hormone receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132546.2-162s1c1
Sequence:CCGGCCACCTAGAATGTGACTTCATCTCGAGATGAAGTCACATTCTAGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132546.2-1220s1c1
Sequence:CCGGGCTTCCTCAATCAAGAGGTGACTCGAGTCACCTCTTGATTGAGGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132546.2-377s1c1
Sequence:CCGGGCACCATCACTGGCTGGTCTACTCGAGTAGACCAGCCAGTGATGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132546.2-1084s1c1
Sequence:CCGGCTTCTCCTTATACCGCTGTTTCTCGAGAAACAGCGGTATAAGGAGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132546.2-981s1c1
Sequence:CCGGTGGGCTGTTTCTCAATATAATCTCGAGATTATATTGAGAAACAGCCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_132546
GHRHR MISSION shRNA shRNA Plasmid DNA
growth hormone releasing hormone receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132546.2-162s1c1
Sequence:CCGGCCACCTAGAATGTGACTTCATCTCGAGATGAAGTCACATTCTAGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132546.2-1220s1c1
Sequence:CCGGGCTTCCTCAATCAAGAGGTGACTCGAGTCACCTCTTGATTGAGGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132546.2-377s1c1
Sequence:CCGGGCACCATCACTGGCTGGTCTACTCGAGTAGACCAGCCAGTGATGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132546.2-1084s1c1
Sequence:CCGGCTTCTCCTTATACCGCTGTTTCTCGAGAAACAGCGGTATAAGGAGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132546.2-981s1c1
Sequence:CCGGTGGGCTGTTTCTCAATATAATCTCGAGATTATATTGAGAAACAGCCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_132546
GHRHR MISSION shRNA Lentiviral Transduction Particles
growth hormone releasing hormone receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132546.2-162s1c1
Sequence:CCGGCCACCTAGAATGTGACTTCATCTCGAGATGAAGTCACATTCTAGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132546.2-1220s1c1
Sequence:CCGGGCTTCCTCAATCAAGAGGTGACTCGAGTCACCTCTTGATTGAGGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132546.2-377s1c1
Sequence:CCGGGCACCATCACTGGCTGGTCTACTCGAGTAGACCAGCCAGTGATGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132546.2-1084s1c1
Sequence:CCGGCTTCTCCTTATACCGCTGTTTCTCGAGAAACAGCGGTATAAGGAGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132546.2-981s1c1
Sequence:CCGGTGGGCTGTTTCTCAATATAATCTCGAGATTATATTGAGAAACAGCCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)