EMAIL THIS PAGE TO A FRIEND

GHRL

ghrelin/obestatin prepropeptide

62 Gene Product Result for
Synonyms: MTLRP
Gene ID:
Human(51738) Summary: This gene encodes ghrelin-obestatin preproprotein, which generates ghrelin and obestatin. Ghrelin is an endogenous ligand for the growth hormone secretagogue receptor and is involved in regulating growth hormone release. Obestatin was initially reported to be an endogenous ligand for the orphan G protein-coupled receptor GPR39 and was involved in satiety and decreased food intake; however, these findings are controversial. Recent reports show that obestatin is involved in inhibiting thirst and anxiety, improving memory, regulating sleep, affecting cell proliferation, and increasing the secretion of pancreatic juice enzymes. Alternative promoters and alternative splicing result in multiple transcript variants, some of which encode different protein isoforms and some of which do not encode a protein but may regulate the ghrelin-obestatin preproprotein expression. In addition, antisense transcripts for this gene have been identified and may also function in regulation of the ghrelin-obestatin preproprotein expression. [provided by RefSeq, Oct 2008]
Mouse(58991) ghrelin
Rat(59301) ghrelin/obestatin prepropeptide
Zebrafish(798613) ghrelin/obestatin preprohormone
cow(281192) ghrelin/obestatin prepropeptide
Horse(100058008) ghrelin/obestatin prepropeptide
domestic cat(493844) ghrelin/obestatin prepropeptide
dog(403587) ghrelin/obestatin prepropeptide
chicken(408185) ghrelin/obestatin prepropeptide
Goat(100861189) ghrelin/obestatin prepropeptide
sheep(442996) ghrelin/obestatin prepropeptide
domestic guinea pig(100717245) ghrelin/obestatin prepropeptide
naked mole-rat(101710248) ghrelin/obestatin prepropeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
O0141 Obestatin human human pricing
O0266 Obestatin mouse, rat synthetic mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016362 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021488 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021488 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021488 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016362 Rosetta Predictions human pricing
NM_021669 Rosetta Predictions rat pricing
NM_021488 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111944 predicted 275
2 SASI_Hs01_00111945 predicted 207
3 SASI_Hs01_00111946 predicted 206
4 SASI_Hs01_00111947 predicted 203
5 SASI_Hs01_00111948 predicted 242
6 SASI_Hs01_00111949 predicted 199
7 SASI_Hs01_00111950 predicted 216
8 SASI_Hs01_00111951 predicted 196
9 SASI_Hs02_00349341 predicted 485
10 SASI_Hs01_00111952 predicted 398
11 SASI_Hs01_00111953 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021669 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106618 predicted 245
2 SASI_Rn01_00106619 predicted 231
3 SASI_Rn01_00106620 predicted 248
4 SASI_Rn01_00106622 predicted 236
5 SASI_Rn01_00106623 predicted 242
6 SASI_Rn01_00106625 predicted 263
7 SASI_Rn01_00106626 predicted 262
8 SASI_Rn02_00262680 predicted 253
9 SASI_Rn02_00262681 predicted 261
10 SASI_Rn01_00106617 predicted 259
11 SASI_Rn01_00106621 predicted 268
12 SASI_Rn01_00106624 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033640 predicted 295
2 SASI_Mm01_00033641 predicted 254
3 SASI_Mm01_00033642 predicted 295
4 SASI_Mm01_00033643 predicted 269
5 SASI_Mm01_00033644 predicted 270
6 SASI_Mm01_00033645 predicted 262
7 SASI_Mm01_00033646 predicted 295
8 SASI_Mm02_00326181 predicted 259
9 SASI_Mm01_00033647 predicted 270
10 SASI_Mm01_00033648 predicted 258
11 SASI_Mm01_00033649 predicted 248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016362
GHRL MISSION shRNA Bacterial Glycerol Stock
ghrelin/obestatin prepropeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016362.3-124s21c1
Sequence:CCGGCAGCTTCCTGAGCCCTGAACACTCGAGTGTTCAGGGCTCAGGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016362.3-292s21c1
Sequence:CCGGTGTTGGAATCAAGCTGTCAGGCTCGAGCCTGACAGCTTGATTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016362.3-345s21c1
Sequence:CCGGGGAAGTTTCTTCAGGACATCCCTCGAGGGATGTCCTGAAGAAACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016362.3-157s21c1
Sequence:CCGGGCAGAGAAAGGAGTCGAAGAACTCGAGTTCTTCGACTCCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016362.1-243s1c1
Sequence:CCGGTGAACTGGAAGTCCGGTTCAACTCGAGTTGAACCGGACTTCCAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016362.1-339s1c1
Sequence:CCGGTCAGGACATCCTCTGGGAAGACTCGAGTCTTCCCAGAGGATGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016362.1-128s1c1
Sequence:CCGGACCAGAGAGTCCAGCAGAGAACTCGAGTTCTCTGCTGGACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016362.1-208s1c1
Sequence:CCGGCCGGAAGATGGAGGTCAAGCACTCGAGTGCTTGACCTCCATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016362.1-268s1c1
Sequence:CCGGCCCTTTGATGTTGGAATCAAGCTCGAGCTTGATTCCAACATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016362
GHRL MISSION shRNA shRNA Plasmid DNA
ghrelin/obestatin prepropeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016362.3-124s21c1
Sequence:CCGGCAGCTTCCTGAGCCCTGAACACTCGAGTGTTCAGGGCTCAGGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016362.3-292s21c1
Sequence:CCGGTGTTGGAATCAAGCTGTCAGGCTCGAGCCTGACAGCTTGATTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016362.3-345s21c1
Sequence:CCGGGGAAGTTTCTTCAGGACATCCCTCGAGGGATGTCCTGAAGAAACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016362.3-157s21c1
Sequence:CCGGGCAGAGAAAGGAGTCGAAGAACTCGAGTTCTTCGACTCCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016362.1-243s1c1
Sequence:CCGGTGAACTGGAAGTCCGGTTCAACTCGAGTTGAACCGGACTTCCAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016362.1-339s1c1
Sequence:CCGGTCAGGACATCCTCTGGGAAGACTCGAGTCTTCCCAGAGGATGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016362.1-128s1c1
Sequence:CCGGACCAGAGAGTCCAGCAGAGAACTCGAGTTCTCTGCTGGACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016362.1-208s1c1
Sequence:CCGGCCGGAAGATGGAGGTCAAGCACTCGAGTGCTTGACCTCCATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016362.1-268s1c1
Sequence:CCGGCCCTTTGATGTTGGAATCAAGCTCGAGCTTGATTCCAACATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016362
GHRL MISSION shRNA Lentiviral Transduction Particles
ghrelin/obestatin prepropeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016362.3-124s21c1
Sequence:CCGGCAGCTTCCTGAGCCCTGAACACTCGAGTGTTCAGGGCTCAGGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016362.3-292s21c1
Sequence:CCGGTGTTGGAATCAAGCTGTCAGGCTCGAGCCTGACAGCTTGATTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016362.3-345s21c1
Sequence:CCGGGGAAGTTTCTTCAGGACATCCCTCGAGGGATGTCCTGAAGAAACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016362.3-157s21c1
Sequence:CCGGGCAGAGAAAGGAGTCGAAGAACTCGAGTTCTTCGACTCCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016362.1-243s1c1
Sequence:CCGGTGAACTGGAAGTCCGGTTCAACTCGAGTTGAACCGGACTTCCAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016362.1-339s1c1
Sequence:CCGGTCAGGACATCCTCTGGGAAGACTCGAGTCTTCCCAGAGGATGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016362.1-128s1c1
Sequence:CCGGACCAGAGAGTCCAGCAGAGAACTCGAGTTCTCTGCTGGACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016362.1-208s1c1
Sequence:CCGGCCGGAAGATGGAGGTCAAGCACTCGAGTGCTTGACCTCCATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016362.1-268s1c1
Sequence:CCGGCCCTTTGATGTTGGAATCAAGCTCGAGCTTGATTCCAACATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021488
GHRL MISSION shRNA Bacterial Glycerol Stock
ghrelin/obestatin prepropeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021488.3-151s1c1
Sequence:CCGGGCAGAGAAAGGAATCCAAGAACTCGAGTTCTTGGATTCCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021488.3-262s1c1
Sequence:CCGGGATCAGGTTCAATGCTCCCTTCTCGAGAAGGGAGCATTGAACCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021488.3-284s1c1
Sequence:CCGGGATGTTGGCATCAAGCTGTCACTCGAGTGACAGCTTGATGCCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021488.3-72s1c1
Sequence:CCGGTGCTGCTACTCAGCATGCTCTCTCGAGAGAGCATGCTGAGTAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021488.3-176s1c1
Sequence:CCGGCCAGCTAAACTGCAGCCACGACTCGAGTCGTGGCTGCAGTTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021488
GHRL MISSION shRNA shRNA Plasmid DNA
ghrelin/obestatin prepropeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021488.3-151s1c1
Sequence:CCGGGCAGAGAAAGGAATCCAAGAACTCGAGTTCTTGGATTCCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021488.3-262s1c1
Sequence:CCGGGATCAGGTTCAATGCTCCCTTCTCGAGAAGGGAGCATTGAACCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021488.3-284s1c1
Sequence:CCGGGATGTTGGCATCAAGCTGTCACTCGAGTGACAGCTTGATGCCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021488.3-72s1c1
Sequence:CCGGTGCTGCTACTCAGCATGCTCTCTCGAGAGAGCATGCTGAGTAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021488.3-176s1c1
Sequence:CCGGCCAGCTAAACTGCAGCCACGACTCGAGTCGTGGCTGCAGTTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021488
GHRL MISSION shRNA Lentiviral Transduction Particles
ghrelin/obestatin prepropeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021488.3-151s1c1
Sequence:CCGGGCAGAGAAAGGAATCCAAGAACTCGAGTTCTTGGATTCCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021488.3-262s1c1
Sequence:CCGGGATCAGGTTCAATGCTCCCTTCTCGAGAAGGGAGCATTGAACCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021488.3-284s1c1
Sequence:CCGGGATGTTGGCATCAAGCTGTCACTCGAGTGACAGCTTGATGCCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021488.3-72s1c1
Sequence:CCGGTGCTGCTACTCAGCATGCTCTCTCGAGAGAGCATGCTGAGTAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021488.3-176s1c1
Sequence:CCGGCCAGCTAAACTGCAGCCACGACTCGAGTCGTGGCTGCAGTTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks