EMAIL THIS PAGE TO A FRIEND

GHSR

growth hormone secretagogue receptor

66 Gene Product Result for
UniProtKB ID: Q92847, Q14D12, Q6ISR8, Q92848, Q96RJ7
Gene ID:
Human(2693) Summary: This gene encodes a member of the G-protein coupled receptor family. The encoded protein may play a role in energy homeostasis and regulation of body weight. Two identified transcript variants are expressed in several tissues and are evolutionary conserved in fish and swine. One transcript, 1a, excises an intron and encodes the functional protein; this protein is the receptor for the Ghrelin ligand and defines a neuroendocrine pathway for growth hormone release. The second transcript (1b) retains the intron and does not function as a receptor for Ghrelin; however, it may function to attenuate activity of isoform 1a. Mutations in this gene are associated with autosomal idiopathic short stature.[provided by RefSeq, Apr 2010]
Mouse(208188) growth hormone secretagogue receptor
Rat(84022) growth hormone secretagogue receptor
chicken(378911) growth hormone secretagogue receptor
dog(100101479) growth hormone secretagogue receptor
cow(514203) growth hormone secretagogue receptor
domestic cat(101083540) growth hormone secretagogue receptor
naked mole-rat(101702096) growth hormone secretagogue receptor
domestic guinea pig(100731433) growth hormone secretagogue receptor
Goat(100860920) growth hormone secretagogue receptor
sheep(443238) growth hormone secretagogue receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
M2910 [D-Trp7, Ala8, D-Phe10]-α-Melanocyte Stimulating Hormone Amide Fragment 6-11 ≥97% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177330 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177330 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177330 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004122 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004122 Rosetta Predictions human pricing
NM_198407 Rosetta Predictions human pricing
NM_032075 Rosetta Predictions rat pricing
NM_177330 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120182 predicted 253
2 SASI_Hs01_00120184 predicted 250
3 SASI_Hs01_00120185 predicted 345
4 SASI_Hs01_00120186 predicted 385
5 SASI_Hs01_00120187 predicted 309
6 SASI_Hs01_00120188 predicted 291
7 SASI_Hs01_00120189 predicted 231
8 SASI_Hs01_00120190 predicted 293
9 SASI_Hs01_00120191 predicted 339
10 SASI_Hs01_00120183 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186488 predicted 256
2 SASI_Hs01_00186490 predicted 247
3 SASI_Hs01_00186491 predicted 343
4 SASI_Hs01_00186492 predicted 387
5 SASI_Hs01_00186493 predicted 306
6 SASI_Hs01_00186494 predicted 296
7 SASI_Hs01_00186495 predicted 233
8 SASI_Hs01_00186496 predicted 295
9 SASI_Hs01_00186497 predicted 337
10 SASI_Hs01_00186489 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094677 predicted 1079
2 SASI_Rn02_00265438 predicted 1050
3 SASI_Rn01_00094678 predicted 633
4 SASI_Rn01_00094680 predicted 1076
5 SASI_Rn01_00094681 predicted 445
6 SASI_Rn02_00265439 predicted 469
7 SASI_Rn01_00094682 predicted 455
8 SASI_Rn01_00094683 predicted 411
9 SASI_Rn01_00094684 predicted 1001
10 SASI_Rn01_00094685 predicted 624
11 SASI_Rn01_00094676 predicted 477
12 SASI_Rn01_00094679 predicted 1042
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155767 predicted 1664
2 SASI_Mm01_00155768 predicted 1781
3 SASI_Mm01_00155769 predicted 1689
4 SASI_Mm01_00155770 predicted 1364
5 SASI_Mm02_00347434 predicted 1782
6 SASI_Mm02_00347435 predicted 1640
7 SASI_Mm01_00155771 predicted 1819
8 SASI_Mm01_00155772 predicted 1239
9 SASI_Mm01_00155773 predicted 666
10 SASI_Mm01_00155774 predicted 1256
11 SASI_Mm01_00155775 predicted 1574
12 SASI_Mm01_00155776 predicted 1135
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177330
GHSR MISSION shRNA Bacterial Glycerol Stock
growth hormone secretagogue receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177330.2-591s1c1
Sequence:CCGGCTCTGCAAACTCTTCCAGTTTCTCGAGAAACTGGAAGAGTTTGCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177330.2-1243s1c1
Sequence:CCGGCCGTGTTCAAACTTCTAGGATCTCGAGATCCTAGAAGTTTGAACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177330.2-1320s1c1
Sequence:CCGGTGGACAAAGTCGAGCATCAATCTCGAGATTGATGCTCGACTTTGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177330.2-1016s1c1
Sequence:CCGGCCACAAACAGACAGTGAAGATCTCGAGATCTTCACTGTCTGTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177330.2-1139s1c1
Sequence:CCGGGCAGATCAGTCAGTACTGCAACTCGAGTTGCAGTACTGACTGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177330
GHSR MISSION shRNA shRNA Plasmid DNA
growth hormone secretagogue receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177330.2-591s1c1
Sequence:CCGGCTCTGCAAACTCTTCCAGTTTCTCGAGAAACTGGAAGAGTTTGCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177330.2-1243s1c1
Sequence:CCGGCCGTGTTCAAACTTCTAGGATCTCGAGATCCTAGAAGTTTGAACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177330.2-1320s1c1
Sequence:CCGGTGGACAAAGTCGAGCATCAATCTCGAGATTGATGCTCGACTTTGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177330.2-1016s1c1
Sequence:CCGGCCACAAACAGACAGTGAAGATCTCGAGATCTTCACTGTCTGTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177330.2-1139s1c1
Sequence:CCGGGCAGATCAGTCAGTACTGCAACTCGAGTTGCAGTACTGACTGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177330
GHSR MISSION shRNA Lentiviral Transduction Particles
growth hormone secretagogue receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177330.2-591s1c1
Sequence:CCGGCTCTGCAAACTCTTCCAGTTTCTCGAGAAACTGGAAGAGTTTGCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177330.2-1243s1c1
Sequence:CCGGCCGTGTTCAAACTTCTAGGATCTCGAGATCCTAGAAGTTTGAACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177330.2-1320s1c1
Sequence:CCGGTGGACAAAGTCGAGCATCAATCTCGAGATTGATGCTCGACTTTGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177330.2-1016s1c1
Sequence:CCGGCCACAAACAGACAGTGAAGATCTCGAGATCTTCACTGTCTGTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177330.2-1139s1c1
Sequence:CCGGGCAGATCAGTCAGTACTGCAACTCGAGTTGCAGTACTGACTGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004122
GHSR MISSION shRNA Bacterial Glycerol Stock
growth hormone secretagogue receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004122.1-341s1c1
Sequence:CCGGTCCTCTGCAAACTCTTCCAATCTCGAGATTGGAAGAGTTTGCAGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004122.1-480s1c1
Sequence:CCGGGAAGCTGGTCATCTTCGTCATCTCGAGATGACGAAGATGACCAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004122.1-675s1c1
Sequence:CCGGCTTCTGTCTCACGGTCCTCTACTCGAGTAGAGGACCGTGAGACAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004122.1-162s1c1
Sequence:CCGGCGTGGTGGGTATCGCTGGCAACTCGAGTTGCCAGCGATACCCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004122.1-267s1c1
Sequence:CCGGTCTGCTCATCTTCCTCTGCATCTCGAGATGCAGAGGAAGATGAGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004122.1-259s21c1
Sequence:CCGGTTCTCCGATCTGCTCATCTTCCTCGAGGAAGATGAGCAGATCGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004122.1-347s21c1
Sequence:CCGGGCAAACTCTTCCAATTCGTCACTCGAGTGACGAATTGGAAGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004122.1-234s21c1
Sequence:CCGGCAACCTCTACCTGTCCAGCATCTCGAGATGCTGGACAGGTAGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004122.1-684s21c1
Sequence:CCGGCACGGTCCTCTACAGTCTCATCTCGAGATGAGACTGTAGAGGACCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004122
GHSR MISSION shRNA shRNA Plasmid DNA
growth hormone secretagogue receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004122.1-341s1c1
Sequence:CCGGTCCTCTGCAAACTCTTCCAATCTCGAGATTGGAAGAGTTTGCAGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004122.1-480s1c1
Sequence:CCGGGAAGCTGGTCATCTTCGTCATCTCGAGATGACGAAGATGACCAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004122.1-675s1c1
Sequence:CCGGCTTCTGTCTCACGGTCCTCTACTCGAGTAGAGGACCGTGAGACAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004122.1-162s1c1
Sequence:CCGGCGTGGTGGGTATCGCTGGCAACTCGAGTTGCCAGCGATACCCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004122.1-267s1c1
Sequence:CCGGTCTGCTCATCTTCCTCTGCATCTCGAGATGCAGAGGAAGATGAGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004122.1-259s21c1
Sequence:CCGGTTCTCCGATCTGCTCATCTTCCTCGAGGAAGATGAGCAGATCGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004122.1-347s21c1
Sequence:CCGGGCAAACTCTTCCAATTCGTCACTCGAGTGACGAATTGGAAGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004122.1-234s21c1
Sequence:CCGGCAACCTCTACCTGTCCAGCATCTCGAGATGCTGGACAGGTAGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004122.1-684s21c1
Sequence:CCGGCACGGTCCTCTACAGTCTCATCTCGAGATGAGACTGTAGAGGACCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004122
GHSR MISSION shRNA Lentiviral Transduction Particles
growth hormone secretagogue receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004122.1-341s1c1
Sequence:CCGGTCCTCTGCAAACTCTTCCAATCTCGAGATTGGAAGAGTTTGCAGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004122.1-480s1c1
Sequence:CCGGGAAGCTGGTCATCTTCGTCATCTCGAGATGACGAAGATGACCAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004122.1-675s1c1
Sequence:CCGGCTTCTGTCTCACGGTCCTCTACTCGAGTAGAGGACCGTGAGACAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004122.1-162s1c1
Sequence:CCGGCGTGGTGGGTATCGCTGGCAACTCGAGTTGCCAGCGATACCCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004122.1-267s1c1
Sequence:CCGGTCTGCTCATCTTCCTCTGCATCTCGAGATGCAGAGGAAGATGAGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004122.1-259s21c1
Sequence:CCGGTTCTCCGATCTGCTCATCTTCCTCGAGGAAGATGAGCAGATCGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004122.1-347s21c1
Sequence:CCGGGCAAACTCTTCCAATTCGTCACTCGAGTGACGAATTGGAAGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004122.1-234s21c1
Sequence:CCGGCAACCTCTACCTGTCCAGCATCTCGAGATGCTGGACAGGTAGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004122.1-684s21c1
Sequence:CCGGCACGGTCCTCTACAGTCTCATCTCGAGATGAGACTGTAGAGGACCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks