EMAIL THIS PAGE TO A FRIEND

GID4

GID complex subunit 4

Synonyms: C17orf39 VID24
UniProtKB ID: Q8IVV7, Q8TEB5, Q9BW50
Gene ID:
Human(79018) Summary: The multiprotein Mediator complex is a coactivator required for activation of RNA polymerase II transcription by DNA bound transcription factors. The protein encoded by this gene is thought to be a subunit of the Mediator complex. This gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
Mouse(66771) GID complex subunit 4, VID24 homolog (S. cerevisiae)
Rat(687192) GID complex subunit 4
Zebrafish(497568) GID complex subunit 4, VID24 homolog (S. cerevisiae)
cow(509503) GID complex subunit 4, VID24 homolog (S. cerevisiae)
domestic cat(101087279) GID complex subunit 4, VID24 homolog (S. cerevisiae)
dog(479524) GID complex subunit 4, VID24 homolog (S. cerevisiae)
sheep(101111644) GID complex subunit 4, VID24 homolog (S. cerevisiae)
domestic guinea pig(100727759) GID complex subunit 4, VID24 homolog (S. cerevisiae)
naked mole-rat(101707825) GID complex subunit 4, VID24 homolog (S. cerevisiae)
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024052 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024052 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024052 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024052 Rosetta Predictions human pricing
NM_025757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033612 predicted 979
2 SASI_Hs01_00033613 predicted 963
3 SASI_Hs01_00033614 predicted 986
4 SASI_Hs01_00033615 predicted 1020
5 SASI_Hs01_00033616 predicted 1003
6 SASI_Hs01_00033617 predicted 1147
7 SASI_Hs01_00033618 predicted 807
8 SASI_Hs01_00033619 predicted 1019
9 SASI_Hs01_00033620 predicted 1002
10 SASI_Hs01_00033621 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165220 predicted 1047
2 SASI_Mm01_00165221 predicted 1045
3 SASI_Mm01_00165222 predicted 1008
4 SASI_Mm01_00165223 predicted 723
5 SASI_Mm01_00165224 predicted 957
6 SASI_Mm01_00165225 predicted 557
7 SASI_Mm01_00165226 predicted 618
8 SASI_Mm01_00165227 predicted 898
9 SASI_Mm02_00328957 predicted 1028
10 SASI_Mm01_00165228 predicted 918
11 SASI_Mm01_00165229 predicted 793
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025757
VALIDATED
GID4 MISSION shRNA Bacterial Glycerol Stock
GID complex subunit 4
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.4-768s21c1
Sequence:CCGGCAACCCTTACAACCTTCTTTGCTCGAGCAAAGAAGGTTGTAAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025757.4-1402s21c1
Sequence:CCGGCTGTTTCTGAACAACCTTAAACTCGAGTTTAAGGTTGTTCAGAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.3-826s21c1
Sequence:CCGGTCCCGGACCACACAATCAAAGCTCGAGCTTTGATTGTGTGGTCCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.3-684s21c1
Sequence:CCGGGATGAAGACGTGGATCGGAAACTCGAGTTTCCGATCCACGTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.3-731s21c1
Sequence:CCGGTCAGTATGCAGAATCATTTAACTCGAGTTAAATGATTCTGCATACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.4-1016s21c1
Sequence:CCGGGCTTCCTTTGCTGGTTTCTATCTCGAGATAGAAACCAGCAAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.4-903s21c1
Sequence:CCGGCATTTAATTCAGACGACTTTGCTCGAGCAAAGTCGTCTGAATTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025757.3-858s1c1
Sequence:CCGGGCTTCCTTTGCTGGTTTCTATCTCGAGATAGAAACCAGCAAAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025757.3-4000s1c1
Sequence:CCGGCGTATGTTACATTGTGGTTTACTCGAGTAAACCACAATGTAACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025757.3-684s1c1
Sequence:CCGGGATGAAGACGTGGATCGGAAACTCGAGTTTCCGATCCACGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025757.3-863s1c1
Sequence:CCGGCTTTGCTGGTTTCTATTACATCTCGAGATGTAATAGAAACCAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025757.3-598s1c1
Sequence:CCGGCAGAGGAATATCCAACCCTTACTCGAGTAAGGGTTGGATATTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025757
VALIDATED
GID4 MISSION shRNA shRNA Plasmid DNA
GID complex subunit 4
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.4-768s21c1
Sequence:CCGGCAACCCTTACAACCTTCTTTGCTCGAGCAAAGAAGGTTGTAAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025757.4-1402s21c1
Sequence:CCGGCTGTTTCTGAACAACCTTAAACTCGAGTTTAAGGTTGTTCAGAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.3-826s21c1
Sequence:CCGGTCCCGGACCACACAATCAAAGCTCGAGCTTTGATTGTGTGGTCCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.3-684s21c1
Sequence:CCGGGATGAAGACGTGGATCGGAAACTCGAGTTTCCGATCCACGTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.3-731s21c1
Sequence:CCGGTCAGTATGCAGAATCATTTAACTCGAGTTAAATGATTCTGCATACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.4-1016s21c1
Sequence:CCGGGCTTCCTTTGCTGGTTTCTATCTCGAGATAGAAACCAGCAAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.4-903s21c1
Sequence:CCGGCATTTAATTCAGACGACTTTGCTCGAGCAAAGTCGTCTGAATTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025757.3-858s1c1
Sequence:CCGGGCTTCCTTTGCTGGTTTCTATCTCGAGATAGAAACCAGCAAAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025757.3-4000s1c1
Sequence:CCGGCGTATGTTACATTGTGGTTTACTCGAGTAAACCACAATGTAACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025757.3-684s1c1
Sequence:CCGGGATGAAGACGTGGATCGGAAACTCGAGTTTCCGATCCACGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025757.3-863s1c1
Sequence:CCGGCTTTGCTGGTTTCTATTACATCTCGAGATGTAATAGAAACCAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025757.3-598s1c1
Sequence:CCGGCAGAGGAATATCCAACCCTTACTCGAGTAAGGGTTGGATATTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025757
VALIDATED
GID4 MISSION shRNA Lentiviral Transduction Particles
GID complex subunit 4
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.4-768s21c1
Sequence:CCGGCAACCCTTACAACCTTCTTTGCTCGAGCAAAGAAGGTTGTAAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025757.4-1402s21c1
Sequence:CCGGCTGTTTCTGAACAACCTTAAACTCGAGTTTAAGGTTGTTCAGAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.3-826s21c1
Sequence:CCGGTCCCGGACCACACAATCAAAGCTCGAGCTTTGATTGTGTGGTCCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.3-684s21c1
Sequence:CCGGGATGAAGACGTGGATCGGAAACTCGAGTTTCCGATCCACGTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.3-731s21c1
Sequence:CCGGTCAGTATGCAGAATCATTTAACTCGAGTTAAATGATTCTGCATACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.4-1016s21c1
Sequence:CCGGGCTTCCTTTGCTGGTTTCTATCTCGAGATAGAAACCAGCAAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025757.4-903s21c1
Sequence:CCGGCATTTAATTCAGACGACTTTGCTCGAGCAAAGTCGTCTGAATTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025757.3-858s1c1
Sequence:CCGGGCTTCCTTTGCTGGTTTCTATCTCGAGATAGAAACCAGCAAAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025757.3-4000s1c1
Sequence:CCGGCGTATGTTACATTGTGGTTTACTCGAGTAAACCACAATGTAACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025757.3-684s1c1
Sequence:CCGGGATGAAGACGTGGATCGGAAACTCGAGTTTCCGATCCACGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025757.3-863s1c1
Sequence:CCGGCTTTGCTGGTTTCTATTACATCTCGAGATGTAATAGAAACCAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025757.3-598s1c1
Sequence:CCGGCAGAGGAATATCCAACCCTTACTCGAGTAAGGGTTGGATATTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024052
VALIDATED
GID4 MISSION shRNA Bacterial Glycerol Stock
GID complex subunit 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024052.4-890s21c1
Sequence:CCGGTCCCAGATCACACGATCAAAGCTCGAGCTTTGATCGTGTGATCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024052.4-634s21c1
Sequence:CCGGTGTGGGTACTTGAAGATTAAACTCGAGTTTAATCTTCAAGTACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024052.4-1008s21c1
Sequence:CCGGGTATCAGTCCCTCAATCTAACCTCGAGGTTAGATTGAGGGACTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024052.4-866s21c1
Sequence:CCGGTGAGGTGGAAGGAACAGTTTCCTCGAGGAAACTGTTCCTTCCACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024052.4-2686s21c1
Sequence:CCGGTGGGCACTTGTGATATCTAAACTCGAGTTTAGATATCACAAGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024052.3-721s1c1
Sequence:CCGGGAATGGAGACTACGTCTTCATCTCGAGATGAAGACGTAGTCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024052.3-865s1c1
Sequence:CCGGCCATAGGAGTTCAGAATGGTACTCGAGTACCATTCTGAACTCCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024052.3-814s1c1
Sequence:CCGGCTACTACATCTGCTTTCAGAACTCGAGTTCTGAAAGCAGATGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024052
VALIDATED
GID4 MISSION shRNA shRNA Plasmid DNA
GID complex subunit 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024052.4-890s21c1
Sequence:CCGGTCCCAGATCACACGATCAAAGCTCGAGCTTTGATCGTGTGATCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024052.4-634s21c1
Sequence:CCGGTGTGGGTACTTGAAGATTAAACTCGAGTTTAATCTTCAAGTACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024052.4-1008s21c1
Sequence:CCGGGTATCAGTCCCTCAATCTAACCTCGAGGTTAGATTGAGGGACTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024052.4-866s21c1
Sequence:CCGGTGAGGTGGAAGGAACAGTTTCCTCGAGGAAACTGTTCCTTCCACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024052.4-2686s21c1
Sequence:CCGGTGGGCACTTGTGATATCTAAACTCGAGTTTAGATATCACAAGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024052.3-721s1c1
Sequence:CCGGGAATGGAGACTACGTCTTCATCTCGAGATGAAGACGTAGTCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024052.3-865s1c1
Sequence:CCGGCCATAGGAGTTCAGAATGGTACTCGAGTACCATTCTGAACTCCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024052.3-814s1c1
Sequence:CCGGCTACTACATCTGCTTTCAGAACTCGAGTTCTGAAAGCAGATGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024052
VALIDATED
GID4 MISSION shRNA Lentiviral Transduction Particles
GID complex subunit 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024052.4-890s21c1
Sequence:CCGGTCCCAGATCACACGATCAAAGCTCGAGCTTTGATCGTGTGATCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024052.4-634s21c1
Sequence:CCGGTGTGGGTACTTGAAGATTAAACTCGAGTTTAATCTTCAAGTACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024052.4-1008s21c1
Sequence:CCGGGTATCAGTCCCTCAATCTAACCTCGAGGTTAGATTGAGGGACTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024052.4-866s21c1
Sequence:CCGGTGAGGTGGAAGGAACAGTTTCCTCGAGGAAACTGTTCCTTCCACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024052.4-2686s21c1
Sequence:CCGGTGGGCACTTGTGATATCTAAACTCGAGTTTAGATATCACAAGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024052.3-721s1c1
Sequence:CCGGGAATGGAGACTACGTCTTCATCTCGAGATGAAGACGTAGTCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024052.3-865s1c1
Sequence:CCGGCCATAGGAGTTCAGAATGGTACTCGAGTACCATTCTGAACTCCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024052.3-814s1c1
Sequence:CCGGCTACTACATCTGCTTTCAGAACTCGAGTTCTGAAAGCAGATGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks