EMAIL THIS PAGE TO A FRIEND

GID8

GID complex subunit 8

57 Gene Product Result for
Synonyms: C20orf11 TWA1
UniProtKB ID: Q9NWU2, E1P5I3, Q8N5M5
Gene ID:
Mouse(76425) GID complex subunit 8 homolog (S. cerevisiae)
Rat(296466) GID complex subunit 8
naked mole-rat(101710746) GID complex subunit 8 homolog (S. cerevisiae)
domestic guinea pig(100734210) GID complex subunit 8 homolog (S. cerevisiae)
sheep(101111114) GID complex subunit 8 homolog (S. cerevisiae)
cow(505570) GID complex subunit 8 homolog (S. cerevisiae)
domestic cat(101096971) GID complex subunit 8 homolog (S. cerevisiae)
dog(488056) GID complex subunit 8 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029607 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029607 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029607 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017896 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017896 Rosetta Predictions human pricing
NM_198743 Rosetta Predictions rat pricing
NM_029607 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199794 predicted 462
2 SASI_Hs01_00199795 predicted 453
3 SASI_Hs01_00199796 predicted 583
4 SASI_Hs01_00199797 predicted 700
5 SASI_Hs01_00199798 predicted 356
6 SASI_Hs01_00199799 predicted 311
7 SASI_Hs01_00199800 predicted 658
8 SASI_Hs01_00199801 predicted 585
9 SASI_Hs01_00199802 predicted 376
10 SASI_Hs01_00199803 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198743 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086565 predicted 650
2 SASI_Rn01_00086566 predicted 305
3 SASI_Rn01_00086567 predicted 252
4 SASI_Rn01_00086569 predicted 777
5 SASI_Rn01_00086570 predicted 224
6 SASI_Rn01_00086571 predicted 415
7 SASI_Rn01_00086572 predicted 712
8 SASI_Rn01_00086573 predicted 213
9 SASI_Rn02_00269967 predicted 469
10 SASI_Rn01_00086574 predicted 194
11 SASI_Rn01_00086568 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087832 predicted 1316
2 SASI_Mm01_00087833 predicted 1245
3 SASI_Mm02_00335588 predicted 840
4 SASI_Mm01_00087834 predicted 735
5 SASI_Mm02_00335589 predicted 786
6 SASI_Mm01_00087835 predicted 1254
7 SASI_Mm01_00087836 predicted 1017
8 SASI_Mm01_00087837 predicted 1175
9 SASI_Mm01_00087838 predicted 740
10 SASI_Mm02_00335590 predicted 849
11 SASI_Mm01_00087839 predicted 1332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029607
VALIDATED
GID8 MISSION shRNA Bacterial Glycerol Stock
GID complex subunit 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029607.1-1664s1c1
Sequence:CCGGTGAACATTACTGATGTGCTTTCTCGAGAAAGCACATCAGTAATGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029607.1-689s1c1
Sequence:CCGGCCAAAGATGAATGGATGGAAACTCGAGTTTCCATCCATTCATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029607.1-748s1c1
Sequence:CCGGCGACTCATCATGAACTACCTACTCGAGTAGGTAGTTCATGATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029607.1-1272s1c1
Sequence:CCGGGCTAGACCAGAAGAAAGTAAACTCGAGTTTACTTTCTTCTGGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029607.1-1177s1c1
Sequence:CCGGAGTGAAGTTAACCAGGCTGTTCTCGAGAACAGCCTGGTTAACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029607
VALIDATED
GID8 MISSION shRNA shRNA Plasmid DNA
GID complex subunit 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029607.1-1664s1c1
Sequence:CCGGTGAACATTACTGATGTGCTTTCTCGAGAAAGCACATCAGTAATGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029607.1-689s1c1
Sequence:CCGGCCAAAGATGAATGGATGGAAACTCGAGTTTCCATCCATTCATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029607.1-748s1c1
Sequence:CCGGCGACTCATCATGAACTACCTACTCGAGTAGGTAGTTCATGATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029607.1-1272s1c1
Sequence:CCGGGCTAGACCAGAAGAAAGTAAACTCGAGTTTACTTTCTTCTGGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029607.1-1177s1c1
Sequence:CCGGAGTGAAGTTAACCAGGCTGTTCTCGAGAACAGCCTGGTTAACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029607
VALIDATED
GID8 MISSION shRNA Lentiviral Transduction Particles
GID complex subunit 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029607.1-1664s1c1
Sequence:CCGGTGAACATTACTGATGTGCTTTCTCGAGAAAGCACATCAGTAATGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029607.1-689s1c1
Sequence:CCGGCCAAAGATGAATGGATGGAAACTCGAGTTTCCATCCATTCATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029607.1-748s1c1
Sequence:CCGGCGACTCATCATGAACTACCTACTCGAGTAGGTAGTTCATGATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029607.1-1272s1c1
Sequence:CCGGGCTAGACCAGAAGAAAGTAAACTCGAGTTTACTTTCTTCTGGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029607.1-1177s1c1
Sequence:CCGGAGTGAAGTTAACCAGGCTGTTCTCGAGAACAGCCTGGTTAACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017896
VALIDATED
GID8 MISSION shRNA Bacterial Glycerol Stock
GID complex subunit 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149626    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017896.2-3277s1c1
Sequence:CCGGGCACACTTTCTTTGCTCCTTTCTCGAGAAAGGAGCAAAGAAAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017896.2-709s1c1
Sequence:CCGGCAAGCTGTGCTAGATTATGAACTCGAGTTCATAATCTAGCACAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017896.2-285s21c1
Sequence:CCGGCCTGGTCACAGAGGGCTTTAACTCGAGTTAAAGCCCTCTGTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017896.2-705s21c1
Sequence:CCGGTAACCAAGCTGTGCTAGATTACTCGAGTAATCTAGCACAGCTTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017896.2-2654s21c1
Sequence:CCGGGATGTGACCCTTGCGATTATTCTCGAGAATAATCGCAAGGGTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017896.2-759s21c1
Sequence:CCGGATTACTGAAACTACTACTTTGCTCGAGCAAAGTAGTAGTTTCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017896.2-459s21c1
Sequence:CCGGGGACACAAACCGGTATCTTTACTCGAGTAAAGATACCGGTTTGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017896
VALIDATED
GID8 MISSION shRNA shRNA Plasmid DNA
GID complex subunit 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149626    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017896.2-3277s1c1
Sequence:CCGGGCACACTTTCTTTGCTCCTTTCTCGAGAAAGGAGCAAAGAAAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017896.2-709s1c1
Sequence:CCGGCAAGCTGTGCTAGATTATGAACTCGAGTTCATAATCTAGCACAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017896.2-285s21c1
Sequence:CCGGCCTGGTCACAGAGGGCTTTAACTCGAGTTAAAGCCCTCTGTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017896.2-705s21c1
Sequence:CCGGTAACCAAGCTGTGCTAGATTACTCGAGTAATCTAGCACAGCTTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017896.2-2654s21c1
Sequence:CCGGGATGTGACCCTTGCGATTATTCTCGAGAATAATCGCAAGGGTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017896.2-759s21c1
Sequence:CCGGATTACTGAAACTACTACTTTGCTCGAGCAAAGTAGTAGTTTCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017896.2-459s21c1
Sequence:CCGGGGACACAAACCGGTATCTTTACTCGAGTAAAGATACCGGTTTGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017896
VALIDATED
GID8 MISSION shRNA Lentiviral Transduction Particles
GID complex subunit 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149626    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017896.2-3277s1c1
Sequence:CCGGGCACACTTTCTTTGCTCCTTTCTCGAGAAAGGAGCAAAGAAAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017896.2-709s1c1
Sequence:CCGGCAAGCTGTGCTAGATTATGAACTCGAGTTCATAATCTAGCACAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017896.2-285s21c1
Sequence:CCGGCCTGGTCACAGAGGGCTTTAACTCGAGTTAAAGCCCTCTGTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017896.2-705s21c1
Sequence:CCGGTAACCAAGCTGTGCTAGATTACTCGAGTAATCTAGCACAGCTTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017896.2-2654s21c1
Sequence:CCGGGATGTGACCCTTGCGATTATTCTCGAGAATAATCGCAAGGGTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017896.2-759s21c1
Sequence:CCGGATTACTGAAACTACTACTTTGCTCGAGCAAAGTAGTAGTTTCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017896.2-459s21c1
Sequence:CCGGGGACACAAACCGGTATCTTTACTCGAGTAAAGATACCGGTTTGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks