EMAIL THIS PAGE TO A FRIEND

GIF

gastric intrinsic factor (vitamin B synthesis)

55 Gene Product Result for
Synonyms: IF IFMH INF TCN3
UniProtKB ID: P27352, B2RAN8, B4DVZ1
Gene ID:
Human(2694) Summary: This gene is a member of the cobalamin transport protein family. It encodes a glycoprotein secreted by parietal cells of the gastric mucosa and is required for adequate absorption of vitamin B12. Vitamin B12 is necessary for erythrocyte maturation and mutations in this gene may lead to congenital pernicious anemia. [provided by RefSeq, Jul 2008]
Mouse(14603) gastric intrinsic factor
Rat(29319) gastric intrinsic factor
chicken(770547) gastric intrinsic factor (vitamin B synthesis)
cow(616252) gastric intrinsic factor (vitamin B synthesis)
Horse(100060988) gastric intrinsic factor (vitamin B synthesis)
domestic cat(101101254) gastric intrinsic factor (vitamin B synthesis)
dog(449477) gastric intrinsic factor (vitamin B synthesis)
sheep(101111743) gastric intrinsic factor (vitamin B synthesis)
domestic guinea pig(100735256) gastric intrinsic factor (vitamin B synthesis)
naked mole-rat(101704686) gastric intrinsic factor (vitamin B synthesis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005142 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005142 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005142 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008118 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008118 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008118 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136261 MISSION® esiRNA esiRNA human GIF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005142 Rosetta Predictions human pricing
NM_017162 Rosetta Predictions rat pricing
NM_008118 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183815 predicted 242
2 SASI_Hs01_00183817 predicted 633
3 SASI_Hs01_00183818 predicted 691
4 SASI_Hs01_00183819 predicted 1282
5 SASI_Hs01_00183820 predicted 1194
6 SASI_Hs01_00183821 predicted 967
7 SASI_Hs01_00183822 predicted 431
8 SASI_Hs01_00183823 predicted 1060
9 SASI_Hs01_00183824 predicted 1200
10 SASI_Hs02_00339071 predicted 978
11 SASI_Hs01_00183816 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051971 predicted 1064
2 SASI_Rn01_00051973 predicted 342
3 SASI_Rn01_00051974 predicted 672
4 SASI_Rn02_00261473 predicted 961
5 SASI_Rn01_00051975 predicted 833
6 SASI_Rn01_00051976 predicted 657
7 SASI_Rn01_00051978 predicted 385
8 SASI_Rn01_00051979 predicted 446
9 SASI_Rn01_00051980 predicted 337
10 SASI_Rn02_00261474 predicted 959
11 SASI_Rn01_00051972 predicted 1168
12 SASI_Rn01_00051977 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008118 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074120 predicted 1110
2 SASI_Mm01_00074121 predicted 477
3 SASI_Mm01_00074123 predicted 1005
4 SASI_Mm01_00074124 predicted 1014
5 SASI_Mm01_00074125 predicted 1234
6 SASI_Mm02_00313179 predicted 1216
7 SASI_Mm01_00074126 predicted 642
8 SASI_Mm02_00313180 predicted 804
9 SASI_Mm01_00074127 predicted 838
10 SASI_Mm02_00313181 predicted 901
11 SASI_Mm01_00074122 predicted 1033
12 SASI_Mm01_00074128 predicted 1208
13 SASI_Mm01_00074129 predicted 833
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005142
GIF MISSION shRNA Bacterial Glycerol Stock
gastric intrinsic factor (vitamin B synthesis)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005142.2-794s21c1
Sequence:CCGGCTACGGATATGATACTCAATGCTCGAGCATTGAGTATCATATCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005142.2-1311s21c1
Sequence:CCGGTGGGTTCAGCTTCTATCAAACCTCGAGGTTTGATAGAAGCTGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005142.2-1155s1c1
Sequence:CCGGCGTCTCTTCTATCAACAATATCTCGAGATATTGTTGATAGAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005142.2-1269s1c1
Sequence:CCGGCGAGCACATCACAGCCAATTTCTCGAGAAATTGGCTGTGATGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005142.2-973s1c1
Sequence:CCGGGCATCTAACATCACTGTCATACTCGAGTATGACAGTGATGTTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005142.2-638s1c1
Sequence:CCGGCCCTGTTTGGTCAGGTACTAACTCGAGTTAGTACCTGACCAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005142.2-290s1c1
Sequence:CCGGCCAGCGACAACAACGATCTAACTCGAGTTAGATCGTTGTTGTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005142
GIF MISSION shRNA shRNA Plasmid DNA
gastric intrinsic factor (vitamin B synthesis)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005142.2-794s21c1
Sequence:CCGGCTACGGATATGATACTCAATGCTCGAGCATTGAGTATCATATCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005142.2-1311s21c1
Sequence:CCGGTGGGTTCAGCTTCTATCAAACCTCGAGGTTTGATAGAAGCTGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005142.2-1155s1c1
Sequence:CCGGCGTCTCTTCTATCAACAATATCTCGAGATATTGTTGATAGAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005142.2-1269s1c1
Sequence:CCGGCGAGCACATCACAGCCAATTTCTCGAGAAATTGGCTGTGATGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005142.2-973s1c1
Sequence:CCGGGCATCTAACATCACTGTCATACTCGAGTATGACAGTGATGTTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005142.2-638s1c1
Sequence:CCGGCCCTGTTTGGTCAGGTACTAACTCGAGTTAGTACCTGACCAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005142.2-290s1c1
Sequence:CCGGCCAGCGACAACAACGATCTAACTCGAGTTAGATCGTTGTTGTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005142
GIF MISSION shRNA Lentiviral Transduction Particles
gastric intrinsic factor (vitamin B synthesis)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005142.2-794s21c1
Sequence:CCGGCTACGGATATGATACTCAATGCTCGAGCATTGAGTATCATATCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005142.2-1311s21c1
Sequence:CCGGTGGGTTCAGCTTCTATCAAACCTCGAGGTTTGATAGAAGCTGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005142.2-1155s1c1
Sequence:CCGGCGTCTCTTCTATCAACAATATCTCGAGATATTGTTGATAGAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005142.2-1269s1c1
Sequence:CCGGCGAGCACATCACAGCCAATTTCTCGAGAAATTGGCTGTGATGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005142.2-973s1c1
Sequence:CCGGGCATCTAACATCACTGTCATACTCGAGTATGACAGTGATGTTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005142.2-638s1c1
Sequence:CCGGCCCTGTTTGGTCAGGTACTAACTCGAGTTAGTACCTGACCAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005142.2-290s1c1
Sequence:CCGGCCAGCGACAACAACGATCTAACTCGAGTTAGATCGTTGTTGTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008118
GIF MISSION shRNA Bacterial Glycerol Stock
gastric intrinsic factor (vitamin B synthesis)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008118.2-1345s1c1
Sequence:CCGGACGGAGTATCTTCTGTCCCATCTCGAGATGGGACAGAAGATACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008118.2-840s1c1
Sequence:CCGGCATACAATACTCAACGAGATTCTCGAGAATCTCGTTGAGTATTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008118.2-972s1c1
Sequence:CCGGCCACCAACTTTAACTGACTATCTCGAGATAGTCAGTTAAAGTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008118.2-1006s1c1
Sequence:CCGGCCACTTCAGTATCTAACATTACTCGAGTAATGTTAGATACTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008118.2-971s1c1
Sequence:CCGGGCCACCAACTTTAACTGACTACTCGAGTAGTCAGTTAAAGTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008118
GIF MISSION shRNA shRNA Plasmid DNA
gastric intrinsic factor (vitamin B synthesis)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008118.2-1345s1c1
Sequence:CCGGACGGAGTATCTTCTGTCCCATCTCGAGATGGGACAGAAGATACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008118.2-840s1c1
Sequence:CCGGCATACAATACTCAACGAGATTCTCGAGAATCTCGTTGAGTATTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008118.2-972s1c1
Sequence:CCGGCCACCAACTTTAACTGACTATCTCGAGATAGTCAGTTAAAGTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008118.2-1006s1c1
Sequence:CCGGCCACTTCAGTATCTAACATTACTCGAGTAATGTTAGATACTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008118.2-971s1c1
Sequence:CCGGGCCACCAACTTTAACTGACTACTCGAGTAGTCAGTTAAAGTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008118
GIF MISSION shRNA Lentiviral Transduction Particles
gastric intrinsic factor (vitamin B synthesis)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008118.2-1345s1c1
Sequence:CCGGACGGAGTATCTTCTGTCCCATCTCGAGATGGGACAGAAGATACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008118.2-840s1c1
Sequence:CCGGCATACAATACTCAACGAGATTCTCGAGAATCTCGTTGAGTATTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008118.2-972s1c1
Sequence:CCGGCCACCAACTTTAACTGACTATCTCGAGATAGTCAGTTAAAGTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008118.2-1006s1c1
Sequence:CCGGCCACTTCAGTATCTAACATTACTCGAGTAATGTTAGATACTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008118.2-971s1c1
Sequence:CCGGGCCACCAACTTTAACTGACTACTCGAGTAGTCAGTTAAAGTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks