EMAIL THIS PAGE TO A FRIEND

GIGYF2

GRB10 interacting GYF protein 2

261 Gene Product Result for
Synonyms: GYF2 PARK11 PERQ2 PERQ3 TNRC15
Gene ID:
Human(26058) Summary: This gene contains CAG trinucleotide repeats and encodes a protein containing several stretches of polyglutamine residues. The encoded protein may be involved in the regulation of tyrosine kinase receptor signaling. This gene is located in a chromosomal region that was genetically linked to Parkinson disease type 11, and mutations in this gene were thought to be causative for this disease. However, more recent studies in different populations have been unable to replicate this association. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(227331) GRB10 interacting GYF protein 2
Rat(100362458) GRB10 interacting GYF protein 2
domestic guinea pig(100732403) GRB10 interacting GYF protein 2
naked mole-rat(101708887) GRB10 interacting GYF protein 2
sheep(101105449) GRB10 interacting GYF protein 2
chicken(424743) GRB10 interacting GYF protein 2
dog(612838) GRB10 interacting GYF protein 2
Horse(100064814) GRB10 interacting GYF protein 2
cow(506913) GRB10 interacting GYF protein 2
domestic cat(101099393) GRB10 interacting GYF protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015575 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146112 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146112 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146112 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001103146 Rosetta Predictions human pricing
NM_001103147 Rosetta Predictions human pricing
NM_001103148 Rosetta Predictions human pricing
NM_015575 Rosetta Predictions human pricing
NM_001110212 Rosetta Predictions mouse pricing
NM_146112 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323533 predicted 1858
2 SASI_Hs02_00323534 predicted 4158
3 SASI_Hs02_00323535 predicted 1783
4 SASI_Hs02_00323536 predicted 359
5 SASI_Hs02_00323537 predicted 3507
6 SASI_Hs02_00323538 predicted 1684
7 SASI_Hs02_00323539 predicted 1824
8 SASI_Hs02_00323540 predicted 4175
9 SASI_Hs02_00323541 predicted 1747
10 SASI_Hs02_00323542 predicted 4149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323543 predicted 1997
2 SASI_Hs02_00323544 predicted 4291
3 SASI_Hs02_00323545 predicted 1921
4 SASI_Hs02_00323546 predicted 425
5 SASI_Hs02_00323547 predicted 3639
6 SASI_Hs02_00323548 predicted 1826
7 SASI_Hs02_00323549 predicted 1953
8 SASI_Hs02_00323550 predicted 4315
9 SASI_Hs02_00323551 predicted 1879
10 SASI_Hs02_00323552 predicted 4281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323553 predicted 1774
2 SASI_Hs02_00323554 predicted 4074
3 SASI_Hs02_00323555 predicted 1703
4 SASI_Hs02_00323556 predicted 292
5 SASI_Hs02_00323557 predicted 3428
6 SASI_Hs02_00323558 predicted 1608
7 SASI_Hs02_00323559 predicted 1738
8 SASI_Hs02_00323560 predicted 4092
9 SASI_Hs02_00323561 predicted 1662
10 SASI_Hs02_00323562 predicted 4060
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066197 predicted 2000
2 SASI_Hs01_00066198 predicted 4304
3 SASI_Hs01_00066200 predicted 1924
4 SASI_Hs01_00066201 predicted 501
5 SASI_Hs02_00348156 predicted 3655
6 SASI_Hs01_00066204 predicted 1830
7 SASI_Hs01_00066206 predicted 1966
8 SASI_Hs02_00348157 predicted 4324
9 SASI_Hs02_00348158 predicted 1889
10 SASI_Hs02_00348159 predicted 4283
11 SASI_Hs01_00066199 predicted 1144
12 SASI_Hs01_00066202 predicted 1389
13 SASI_Hs01_00066203 predicted 708
14 SASI_Hs01_00066205 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304966 predicted 1677
2 SASI_Mm02_00304967 predicted 1648
3 SASI_Mm02_00304968 predicted 1822
4 SASI_Mm02_00304969 predicted 3537
5 SASI_Mm02_00304970 predicted 1268
6 SASI_Mm02_00304971 predicted 267
7 SASI_Mm02_00304972 predicted 1748
8 SASI_Mm02_00304973 predicted 301
9 SASI_Mm02_00304974 predicted 3484
10 SASI_Mm02_00304975 predicted 1713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146112 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137154 predicted 1728
2 SASI_Mm01_00137155 predicted 1698
3 SASI_Mm01_00137156 predicted 1868
4 SASI_Mm01_00137157 predicted 3588
5 SASI_Mm01_00137158 predicted 1319
6 SASI_Mm01_00137159 predicted 297
7 SASI_Mm01_00137160 predicted 1795
8 SASI_Mm01_00137161 predicted 337
9 SASI_Mm01_00137162 predicted 3537
10 SASI_Mm02_00341768 predicted 1757
11 SASI_Mm01_00137163 predicted 935
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015575
GIGYF2 MISSION shRNA Bacterial Glycerol Stock
GRB10 interacting GYF protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015575.3-1930s21c1
Sequence:CCGGAGCAATGCAGAAGTGGTATTACTCGAGTAATACCACTTCTGCATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015575.3-3850s21c1
Sequence:CCGGTGATTATATCAGGGCCTATTTCTCGAGAAATAGGCCCTGATATAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015575.2-3383s1c1
Sequence:CCGGGCAACCAAACAGAGCTCGTAACTCGAGTTACGAGCTCTGTTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015575.2-2817s1c1
Sequence:CCGGCAGGAAGAATTGTTACGCAAACTCGAGTTTGCGTAACAATTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015575.2-4028s1c1
Sequence:CCGGCCATTCAGTATTTCAGACCAACTCGAGTTGGTCTGAAATACTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015575.2-890s1c1
Sequence:CCGGGCATGAATTTATACGCTCAGACTCGAGTCTGAGCGTATAAATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015575.2-2703s1c1
Sequence:CCGGCGGGAGCAAGAAATTGCATTACTCGAGTAATGCAATTTCTTGCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015575.2-4017s1c1
Sequence:CCGGCACAGTACACTCCATTCAGTACTCGAGTACTGAATGGAGTGTACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015575.2-924s1c1
Sequence:CCGGCGCATCTTTAGAGAGGAACAACTCGAGTTGTTCCTCTCTAAAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015575.2-4311s1c1
Sequence:CCGGGCAACAAATCACAGAACCGATCTCGAGATCGGTTCTGTGATTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015575
GIGYF2 MISSION shRNA shRNA Plasmid DNA
GRB10 interacting GYF protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015575.3-1930s21c1
Sequence:CCGGAGCAATGCAGAAGTGGTATTACTCGAGTAATACCACTTCTGCATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015575.3-3850s21c1
Sequence:CCGGTGATTATATCAGGGCCTATTTCTCGAGAAATAGGCCCTGATATAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015575.2-3383s1c1
Sequence:CCGGGCAACCAAACAGAGCTCGTAACTCGAGTTACGAGCTCTGTTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015575.2-2817s1c1
Sequence:CCGGCAGGAAGAATTGTTACGCAAACTCGAGTTTGCGTAACAATTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015575.2-4028s1c1
Sequence:CCGGCCATTCAGTATTTCAGACCAACTCGAGTTGGTCTGAAATACTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015575.2-890s1c1
Sequence:CCGGGCATGAATTTATACGCTCAGACTCGAGTCTGAGCGTATAAATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015575.2-2703s1c1
Sequence:CCGGCGGGAGCAAGAAATTGCATTACTCGAGTAATGCAATTTCTTGCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015575.2-4017s1c1
Sequence:CCGGCACAGTACACTCCATTCAGTACTCGAGTACTGAATGGAGTGTACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015575.2-924s1c1
Sequence:CCGGCGCATCTTTAGAGAGGAACAACTCGAGTTGTTCCTCTCTAAAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015575.2-4311s1c1
Sequence:CCGGGCAACAAATCACAGAACCGATCTCGAGATCGGTTCTGTGATTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015575
GIGYF2 MISSION shRNA Lentiviral Transduction Particles
GRB10 interacting GYF protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015575.3-1930s21c1
Sequence:CCGGAGCAATGCAGAAGTGGTATTACTCGAGTAATACCACTTCTGCATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015575.3-3850s21c1
Sequence:CCGGTGATTATATCAGGGCCTATTTCTCGAGAAATAGGCCCTGATATAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015575.2-3383s1c1
Sequence:CCGGGCAACCAAACAGAGCTCGTAACTCGAGTTACGAGCTCTGTTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015575.2-2817s1c1
Sequence:CCGGCAGGAAGAATTGTTACGCAAACTCGAGTTTGCGTAACAATTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015575.2-4028s1c1
Sequence:CCGGCCATTCAGTATTTCAGACCAACTCGAGTTGGTCTGAAATACTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015575.2-890s1c1
Sequence:CCGGGCATGAATTTATACGCTCAGACTCGAGTCTGAGCGTATAAATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015575.2-2703s1c1
Sequence:CCGGCGGGAGCAAGAAATTGCATTACTCGAGTAATGCAATTTCTTGCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015575.2-4017s1c1
Sequence:CCGGCACAGTACACTCCATTCAGTACTCGAGTACTGAATGGAGTGTACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015575.2-924s1c1
Sequence:CCGGCGCATCTTTAGAGAGGAACAACTCGAGTTGTTCCTCTCTAAAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015575.2-4311s1c1
Sequence:CCGGGCAACAAATCACAGAACCGATCTCGAGATCGGTTCTGTGATTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146112
VALIDATED
GIGYF2 MISSION shRNA Bacterial Glycerol Stock
GRB10 interacting GYF protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146112.4-377s21c1
Sequence:CCGGCCCTTTGATCTTCTGGAGAAACTCGAGTTTCTCCAGAAGATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146112.4-3734s21c1
Sequence:CCGGGACTATACCAGGGCCTATTTACTCGAGTAAATAGGCCCTGGTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146112.4-4477s21c1
Sequence:CCGGATACCGGCAAAGGGCCTTAACCTCGAGGTTAAGGCCCTTTGCCGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146112.4-335s21c1
Sequence:CCGGCGAGAAGAAATGTTAGCACTTCTCGAGAAGTGCTAACATTTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146112.4-3652s21c1
Sequence:CCGGTGCCCTTAATACGGCAAATAACTCGAGTTATTTGCCGTATTAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146112.2-323s1c1
Sequence:CCGGCCCTTTGATCTTCTGGAGAAACTCGAGTTTCTCCAGAAGATCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146112.2-281s1c1
Sequence:CCGGCGAGAAGAAATGTTAGCACTTCTCGAGAAGTGCTAACATTTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146112.2-1675s1c1
Sequence:CCGGCGACGAAAGATTGACATCAAACTCGAGTTTGATGTCAATCTTTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146112.2-3261s1c1
Sequence:CCGGGCACACATTCCAACCTGCATACTCGAGTATGCAGGTTGGAATGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146112
VALIDATED
GIGYF2 MISSION shRNA shRNA Plasmid DNA
GRB10 interacting GYF protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146112.4-377s21c1
Sequence:CCGGCCCTTTGATCTTCTGGAGAAACTCGAGTTTCTCCAGAAGATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146112.4-3734s21c1
Sequence:CCGGGACTATACCAGGGCCTATTTACTCGAGTAAATAGGCCCTGGTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146112.4-4477s21c1
Sequence:CCGGATACCGGCAAAGGGCCTTAACCTCGAGGTTAAGGCCCTTTGCCGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146112.4-335s21c1
Sequence:CCGGCGAGAAGAAATGTTAGCACTTCTCGAGAAGTGCTAACATTTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146112.4-3652s21c1
Sequence:CCGGTGCCCTTAATACGGCAAATAACTCGAGTTATTTGCCGTATTAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146112.2-323s1c1
Sequence:CCGGCCCTTTGATCTTCTGGAGAAACTCGAGTTTCTCCAGAAGATCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146112.2-281s1c1
Sequence:CCGGCGAGAAGAAATGTTAGCACTTCTCGAGAAGTGCTAACATTTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146112.2-1675s1c1
Sequence:CCGGCGACGAAAGATTGACATCAAACTCGAGTTTGATGTCAATCTTTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146112.2-3261s1c1
Sequence:CCGGGCACACATTCCAACCTGCATACTCGAGTATGCAGGTTGGAATGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146112
VALIDATED
GIGYF2 MISSION shRNA Lentiviral Transduction Particles
GRB10 interacting GYF protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146112.4-377s21c1
Sequence:CCGGCCCTTTGATCTTCTGGAGAAACTCGAGTTTCTCCAGAAGATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146112.4-3734s21c1
Sequence:CCGGGACTATACCAGGGCCTATTTACTCGAGTAAATAGGCCCTGGTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146112.4-4477s21c1
Sequence:CCGGATACCGGCAAAGGGCCTTAACCTCGAGGTTAAGGCCCTTTGCCGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146112.4-335s21c1
Sequence:CCGGCGAGAAGAAATGTTAGCACTTCTCGAGAAGTGCTAACATTTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146112.4-3652s21c1
Sequence:CCGGTGCCCTTAATACGGCAAATAACTCGAGTTATTTGCCGTATTAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146112.2-323s1c1
Sequence:CCGGCCCTTTGATCTTCTGGAGAAACTCGAGTTTCTCCAGAAGATCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146112.2-281s1c1
Sequence:CCGGCGAGAAGAAATGTTAGCACTTCTCGAGAAGTGCTAACATTTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146112.2-1675s1c1
Sequence:CCGGCGACGAAAGATTGACATCAAACTCGAGTTTGATGTCAATCTTTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146112.2-3261s1c1
Sequence:CCGGGCACACATTCCAACCTGCATACTCGAGTATGCAGGTTGGAATGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks