EMAIL THIS PAGE TO A FRIEND

GIMAP1

GTPase, IMAP family member 1

59 Gene Product Result for
Synonyms: HIMAP1 IMAP1 IMAP38
UniProtKB ID: Q8WWP7, B2RCI3, Q8NAZ0
Gene ID:
Human(170575) Summary: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. This gene is thought to be involved in the differentiation of T helper (Th) cells of the Th1 lineage, and the related mouse gene has been shown to be critical for the development of mature B and T lymphocytes. Read-through transcription exists between this gene and the downstream GIMAP5 (GTPase, IMAP family member 5) gene. [provided by RefSeq, Dec 2010]
Mouse(16205) GTPase, IMAP family member 1
Rat(312312) GTPase, IMAP family member 1
chicken(429681) GTPase, IMAP family member 1
domestic cat(101094088) GTPase, IMAP family member 1
cow(615733) GTPase, IMAP family member 1
dog(100686984) GTPase, IMAP family member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130759 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130759 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130759 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008376 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008376 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008376 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130759 Rosetta Predictions human pricing
NM_001034849 Rosetta Predictions rat pricing
NM_008376 Rosetta Predictions mouse pricing
NM_175860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179391 predicted 1000
2 SASI_Hs01_00179392 predicted 362
3 SASI_Hs01_00179393 predicted 731
4 SASI_Hs01_00179394 predicted 369
5 SASI_Hs01_00179395 predicted 226
6 SASI_Hs01_00179396 predicted 711
7 SASI_Hs01_00179397 predicted 733
8 SASI_Hs01_00179399 predicted 997
9 SASI_Hs02_00362778 predicted 565
10 SASI_Hs02_00362779 predicted 572
11 SASI_Hs01_00179390 predicted 352
12 SASI_Hs01_00179398 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120435 predicted 591
2 SASI_Rn01_00120436 predicted 456
3 SASI_Rn01_00120437 predicted 368
4 SASI_Rn01_00120438 predicted 458
5 SASI_Rn01_00120439 predicted 201
6 SASI_Rn01_00120440 predicted 772
7 SASI_Rn01_00120441 predicted 259
8 SASI_Rn01_00120442 predicted 230
9 SASI_Rn01_00120443 predicted 562
10 SASI_Rn01_00120444 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057671 predicted 411
2 SASI_Mm01_00057672 predicted 631
3 SASI_Mm01_00057673 predicted 887
4 SASI_Mm01_00057674 predicted 409
5 SASI_Mm01_00057675 predicted 1054
6 SASI_Mm01_00057676 predicted 524
7 SASI_Mm01_00057677 predicted 629
8 SASI_Mm01_00057678 predicted 816
9 SASI_Mm01_00057679 predicted 1004
10 SASI_Mm02_00313740 predicted 1259
11 SASI_Mm01_00057680 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100828 predicted 401
2 SASI_Mm01_00100829 predicted 627
3 SASI_Mm01_00100830 predicted 880
4 SASI_Mm01_00100831 predicted 406
5 SASI_Mm01_00100832 predicted 1048
6 SASI_Mm01_00100833 predicted 512
7 SASI_Mm01_00100834 predicted 628
8 SASI_Mm01_00100835 predicted 809
9 SASI_Mm01_00100836 predicted 995
10 SASI_Mm02_00346682 predicted 1254
11 SASI_Mm01_00100837 predicted 201
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130759
GIMAP1 MISSION shRNA Bacterial Glycerol Stock
GTPase, IMAP family member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130759.2-742s1c1
Sequence:CCGGCATTACTCCAACGAGGTGTATCTCGAGATACACCTCGTTGGAGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130759.2-123s1c1
Sequence:CCGGTGTCTATGGTTTAGAAGAGAACTCGAGTTCTCTTCTAAACCATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130759.2-355s1c1
Sequence:CCGGCAAGTGTCCAAGACAGATCCTCTCGAGAGGATCTGTCTTGGACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130759.2-570s1c1
Sequence:CCGGCCTGCACGATTACGTGAGCAACTCGAGTTGCTCACGTAATCGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130759.2-635s1c1
Sequence:CCGGGCCGGGTCTGTGCCTTTGATACTCGAGTATCAAAGGCACAGACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130759.2-1094s21c1
Sequence:CCGGGAATCCTGTAGTTTCAGGCATCTCGAGATGCCTGAAACTACAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130759.2-166s21c1
Sequence:CCGGACGCGGAGGCTCATCCTTGTTCTCGAGAACAAGGATGAGCCTCCGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130759.2-522s21c1
Sequence:CCGGATGGATGGTCATCGTCTTCACCTCGAGGTGAAGACGATGACCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130759.2-326s21c1
Sequence:CCGGTCGTGGACACTCCGGACATTTCTCGAGAAATGTCCGGAGTGTCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130759.2-1036s21c1
Sequence:CCAGCTTGGTTAAGGGAGGCTGAATCTCGAGATTCAGCCTCCCTTAACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130759
GIMAP1 MISSION shRNA shRNA Plasmid DNA
GTPase, IMAP family member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130759.2-742s1c1
Sequence:CCGGCATTACTCCAACGAGGTGTATCTCGAGATACACCTCGTTGGAGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130759.2-123s1c1
Sequence:CCGGTGTCTATGGTTTAGAAGAGAACTCGAGTTCTCTTCTAAACCATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130759.2-355s1c1
Sequence:CCGGCAAGTGTCCAAGACAGATCCTCTCGAGAGGATCTGTCTTGGACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130759.2-570s1c1
Sequence:CCGGCCTGCACGATTACGTGAGCAACTCGAGTTGCTCACGTAATCGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130759.2-635s1c1
Sequence:CCGGGCCGGGTCTGTGCCTTTGATACTCGAGTATCAAAGGCACAGACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130759.2-1094s21c1
Sequence:CCGGGAATCCTGTAGTTTCAGGCATCTCGAGATGCCTGAAACTACAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130759.2-166s21c1
Sequence:CCGGACGCGGAGGCTCATCCTTGTTCTCGAGAACAAGGATGAGCCTCCGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130759.2-522s21c1
Sequence:CCGGATGGATGGTCATCGTCTTCACCTCGAGGTGAAGACGATGACCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130759.2-326s21c1
Sequence:CCGGTCGTGGACACTCCGGACATTTCTCGAGAAATGTCCGGAGTGTCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130759.2-1036s21c1
Sequence:CCAGCTTGGTTAAGGGAGGCTGAATCTCGAGATTCAGCCTCCCTTAACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130759
GIMAP1 MISSION shRNA Lentiviral Transduction Particles
GTPase, IMAP family member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130759.2-742s1c1
Sequence:CCGGCATTACTCCAACGAGGTGTATCTCGAGATACACCTCGTTGGAGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130759.2-123s1c1
Sequence:CCGGTGTCTATGGTTTAGAAGAGAACTCGAGTTCTCTTCTAAACCATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130759.2-355s1c1
Sequence:CCGGCAAGTGTCCAAGACAGATCCTCTCGAGAGGATCTGTCTTGGACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130759.2-570s1c1
Sequence:CCGGCCTGCACGATTACGTGAGCAACTCGAGTTGCTCACGTAATCGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130759.2-635s1c1
Sequence:CCGGGCCGGGTCTGTGCCTTTGATACTCGAGTATCAAAGGCACAGACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130759.2-1094s21c1
Sequence:CCGGGAATCCTGTAGTTTCAGGCATCTCGAGATGCCTGAAACTACAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130759.2-166s21c1
Sequence:CCGGACGCGGAGGCTCATCCTTGTTCTCGAGAACAAGGATGAGCCTCCGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130759.2-522s21c1
Sequence:CCGGATGGATGGTCATCGTCTTCACCTCGAGGTGAAGACGATGACCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130759.2-326s21c1
Sequence:CCGGTCGTGGACACTCCGGACATTTCTCGAGAAATGTCCGGAGTGTCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130759.2-1036s21c1
Sequence:CCAGCTTGGTTAAGGGAGGCTGAATCTCGAGATTCAGCCTCCCTTAACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008376
GIMAP1 MISSION shRNA Bacterial Glycerol Stock
GTPase, IMAP family member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008376.3-1264s1c1
Sequence:CCGGCACCTGAATATAAGCCACAAACTCGAGTTTGTGGCTTATATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008376.3-816s1c1
Sequence:CCGGGCACTACTCCAATGAGGTGTACTCGAGTACACCTCATTGGAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008376.3-978s1c1
Sequence:CCGGGAGGCGTGGTTTCTCTGTCTTCTCGAGAAGACAGAGAAACCACGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008376.3-573s1c1
Sequence:CCGGGTTATTCGGGAAGCAGGTGATCTCGAGATCACCTGCTTCCCGAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008376.3-276s1c1
Sequence:CCGGCGGCAAGAGTGCCACTGGCAACTCGAGTTGCCAGTGGCACTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008376
GIMAP1 MISSION shRNA shRNA Plasmid DNA
GTPase, IMAP family member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008376.3-1264s1c1
Sequence:CCGGCACCTGAATATAAGCCACAAACTCGAGTTTGTGGCTTATATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008376.3-816s1c1
Sequence:CCGGGCACTACTCCAATGAGGTGTACTCGAGTACACCTCATTGGAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008376.3-978s1c1
Sequence:CCGGGAGGCGTGGTTTCTCTGTCTTCTCGAGAAGACAGAGAAACCACGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008376.3-573s1c1
Sequence:CCGGGTTATTCGGGAAGCAGGTGATCTCGAGATCACCTGCTTCCCGAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008376.3-276s1c1
Sequence:CCGGCGGCAAGAGTGCCACTGGCAACTCGAGTTGCCAGTGGCACTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008376
GIMAP1 MISSION shRNA Lentiviral Transduction Particles
GTPase, IMAP family member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008376.3-1264s1c1
Sequence:CCGGCACCTGAATATAAGCCACAAACTCGAGTTTGTGGCTTATATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008376.3-816s1c1
Sequence:CCGGGCACTACTCCAATGAGGTGTACTCGAGTACACCTCATTGGAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008376.3-978s1c1
Sequence:CCGGGAGGCGTGGTTTCTCTGTCTTCTCGAGAAGACAGAGAAACCACGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008376.3-573s1c1
Sequence:CCGGGTTATTCGGGAAGCAGGTGATCTCGAGATCACCTGCTTCCCGAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008376.3-276s1c1
Sequence:CCGGCGGCAAGAGTGCCACTGGCAACTCGAGTTGCCAGTGGCACTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks